Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 810

1 members and 809 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,909
Threads: 249,113
Posts: 2,572,174
Top Poster: JLC (31,651)
Welcome to our newest member, KoreyBuchanan
Results 1 to 2 of 2
  1. #1
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Available animals








    2016 animals:

    0.1 Firefly — $150
    1.0 Bellyfly — $200
    1.0 Super Fire [possible Pastel, possible SuperPastel, possible Yellowbelly] — $550 (pictured)
    1.0 PurplePassion Pinstripe — $450 (pictured)
    1.0 Enchi — $75
    0.1 PurplePassion — $450
    1.0 Jigsaw — $125
    1.0 Woma Yellowbelly — $100
    0.1 Woma Yellowbelly — $100
    1.0 Butter Pastel Woma Yellowbelly — $300 (pictured)
    0.1 OrangeDream Pastel Yellowbelly — $500 (pictured)
    1.0 OrangeDream Yellowbelly — $300
    0.1 OrangeDream Yellowbelly — $400
    0.1 OrangeDream Yellowbelly — $400
    1.0 Yellowbelly — $40
    1.0 Yellowbelly — $40
    1.0 het Albino — $30
    1.0 het Albino — $30
    0.1 het Albino — $30
    0.1 het Albino — $30
    1.0 Woma het Albino — $100
    1.0 Woma het Albino — $100
    0.1 Woma het Albino — $100
    0.1 Woma het Albino — $100
    1.0 Albino — $200
    1.0 Candino — $300
    1.0 Albino Pinstripe — $250
    1.0 Albino Pinstripe — $250
    1.0 Enchi Yellowbelly — $125
    1.0 Butter OrangeDream Yellowbelly — $350
    1.0 Butter OrangeDream Pastel Yellowbelly — $450
    1.0 Butter Pastel Yellowbelly — $125
    1.0 Butter Enchi Pastel Yellowbelly — $400 (pictured)
    1.0 BlackPewter Yellowbelly — $250
    1.0 BlackPewter Yellowbelly — $250
    1.0 Butter Yellowbelly — $100
    0.1 Butter Yellowbelly — $125
    0.1 BlackPastel Yellowbelly — $125
    0.1 BlackPastel Yellowbelly — $125
    1.0 BlackPewter Butter Yellowbelly — $350
    0.1 Lesser RedStripe 50% possible het Hypo — $400
    1.0 RedStripe 50% possible het Hypo — $150
    1.0 RedStripe 50% possible het Hypo — $150
    1.0 RedStripe 50% possible het Hypo — $150
    1.0 RedStripe 50% possible het Hypo — $150
    1.0 50% possible het Hypo — $30
    0.1 50% possible het Hypo — $30

    Older animals:

    1.0 2014 Ivory Butter Pastel (proven breeder) — $500
    1.0 2015 Yellowbelly het DesertGhost — $150
    1.0 2015 Yellowbelly het DesertGhost — $150
    1.0 Enchi Mojave (proven breeder) — $200
    1.0 RedStripe (proven breeder) — $200
    1.0 2015 Lesser — $100
    0.1 2013 Dragonfly — $400
    0.1 Lesser het Hypo (proven breeder) — $300
    0.1 BlackPastel (proverb breeder) — $200




    All prices plus shipping through SYR, weather permitting (or I am willing to meet within a reasonable distance from Hagerstown, MD.)

    I may entertain trades for other ball pythons that will fit into my breeding program.

    Feel free to email or PM me if you are interested or have any questions.

    Cheers
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. #2
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    Updated list of available animals


    2016 animals:
    0.1 Orange Dream Pastel Woma Yellowbelly — $800
    1.0 Albino — $200
    1.0 Albino — $200
    1.0 Candino — $300
    0.1 Butter Yellowbelly — $150
    0.1 Lesser RedStripe 50% possible het Hypo — $400
    1.0 RedStripe 50% possible het Hypo — $150
    1.0 RedStripe 50% possible het Hypo — $150

    Older animals:
    1.0 Yellowbelly het DesertGhost — $150
    1.0 Enchi Mojave (proven breeder) — $200
    0.1 Dragonfly — $400
    0.1 Lesser het Hypo (proven breeder) — $300
    1.0 Albino Woma (proven breeder) — $300
    1.0 Albino (proven breeder) — $250
    0.1 Albino (proven breeder) — $400
    0.1 Woma (proven breeder) — $150
    0.1 Mojave — $300
    1.0 WT — $30
    0.1 WT (PET ONLY) — $30

    All prices plus shipping through SYR, weather permitting (or I am willing to meet within a reasonable distance from Frederick, MD or Winchester, VA)

    I may entertain trades for other ball pythons that will fit into my breeding program.

    Feel free to email or PM me if you are interested or have any questions.

    Cheers
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1