» Site Navigation
2 members and 1,921 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,049
Threads: 249,209
Posts: 2,572,709
Top Poster: JLC (31,651)
Welcome to our newest member, Mikvik
|
-
Registered User
I need help with figuring out what line of ghost this is.

I picked this guy up yesterday from someone off of Craigslist who purchased it from a local breeder. When I purchased it I was told he is a Ghost Hidden Gene Woma Pastel. I did some research online last night and found that not all lines of Ghost are compatible so I need some help figuring out what exactly he is.
Thanks,
Tommy
-
-
The only way to know what type of Hypo he is would be to breed against known lines and see if you get visuals. Statistically, your odds are pretty good he will be compatible with the more common lines (Orange, Butterscotch, Peach, etc.)
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: I need help with figuring out what line of ghost this is.
 Originally Posted by tommyboy585

I picked this guy up yesterday from someone off of Craigslist who purchased it from a local breeder. When I purchased it I was told he is a Ghost Hidden Gene Woma Pastel. I did some research online last night and found that not all lines of Ghost are compatible so I need some help figuring out what exactly he is.
Thanks,
Tommy
You can't unless you breed it, that's why buying from a breeder that keep good track of lineage is always best.
Now the good news is that most commonly worked with lines are compatible.
Last edited by Stewart_Reptiles; 05-04-2017 at 09:56 AM.
-
The Following User Says Thank You to Stewart_Reptiles For This Useful Post:
-
Registered User
Re: I need help with figuring out what line of ghost this is.
Yeah... I thought that's what everyone was going to say. All my other ones I purchased directly from the breeder. But I got a REALLY good deal on him so I couldn't pass it up. Does it look like he has hidden gene woma and pastel in him also?
Last edited by tommyboy585; 05-04-2017 at 11:13 AM.
-
-
I would say it does look like a Pastel HGW to me.
-
-
Registered User
Re: I need help with figuring out what line of ghost this is.
 Originally Posted by PitOnTheProwl
I would say it does look like a Pastel HGW to me.
Great thanks man! With the Ghost gene in him also it is hard for me to tell for sure what else is going on.
Last edited by tommyboy585; 05-04-2017 at 08:44 PM.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|