» Site Navigation
0 members and 761 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,909
Threads: 249,108
Posts: 2,572,139
Top Poster: JLC (31,651)
|
-
-
-
I would lean toward the hognose, especially given you have a toddler with an interest in snakes. Womas, by and large, have a tendency to be nippy/bitey whereas the worst I have had a hognose do is headbutt me while bluffing
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
TattedLass253 (04-29-2017)
-
Re: 2nd snake: Woma or Western Hognose?
As someone with several womas, I do not recommend them for people new to the hobby. I love em to death, but young ones tend to be very food smell oriented and excitable, which leads to lots of "ooohhh, can I eat That"? They can also be fairly quick, which can be disconcerting to people used to the slower pace of BPs. Not to say they don't tame down with good handling, just that they are prone to being 6ft derpers.
Just my .02
Cheers,
Kat
-
The Following 2 Users Say Thank You to janeothejungle For This Useful Post:
-
My two cents would be in favor of a hognose. They are extremely fun little snakes. Easy to handle, not nippy, and diurnal so active more during the day.
I don't have much experience with them, but I am currently "snake-sitting" a hognose for a friend and have fallen in love. A hognose was on my wishlist prior to spending time with the little guy I'm watching now, but since have sky-rocketed towards the top of my wishlist. I'm actually pretty sure my friend just wants me to keep the snake I'm watching, but if not, I'm going to be adding one as soon as she takes this little guy back.
I have no experience with womas, but from what I understand they can be a bit nippy and probably better suited for more experienced keepers.
I also think the hognose would be a great snake for your child to grow up with. They are very easy to handle, are pretty slow-moving and their size is extremely manageable for little hands.
That's my two cents. Good luck!!
-
The Following User Says Thank You to Craiga 01453 For This Useful Post:
TattedLass253 (04-29-2017)
-
Get what you want, do the research and decide what's best for you.
-
-
I love my hognose SO much!! He's my favorite snake of five species (ball, corn, rat, sand, hog). He has attitude but doesn't bite, his face is adorable, he super easy to feed, he fasts in the winter making him a cost free pet while bruminating, never has shed issues, just all around a wonderful snake to own.
How can you resist that face?
-
The Following 3 Users Say Thank You to piedlover79 For This Useful Post:
Craiga 01453 (04-29-2017),TattedLass253 (04-29-2017),the_rotten1 (04-29-2017)
-
I do not know much about hoggies but I can tell you the Womas only downfall is it's rediculous feeding response. If you can be patient and learn to work with and around that they are absolutely one of the most enjoyable snakes I have worked with. All three of ours are absolutely fearless and non agressive/defensive. Of the 3, 2 are very easy to handle. Once they realize it is not feeding time they welcome being handled. The 3rd tries to eat the snake hook and anything she can get her mouth on for a good 10 minutes before she calms down and realizes it is not feeding time.
1.0 Albino Black Pastel Pinstripe BP "Menolo"
0.1 Albino Spider BP "Ginger"
0.1 Black Pastel Het. Albino "Jasmine"
1.0 Woma python "Stitch"
0.1 Woma python "Milo"
0.1 Woma python "Millie"
1.0 Blackhead Python
0.1 Blackhead Python
0.1 Blackhead Python
1.0 Black South African Boerboel "Midas"
0.1 Chocolate Lab "Coco"
-
The Following 2 Users Say Thank You to enginee837 For This Useful Post:
jmcrook (04-29-2017),TattedLass253 (04-29-2017)
-
-
The Following User Says Thank You to TattedLass253 For This Useful Post:
Craiga 01453 (04-29-2017)
-
Registered User
Re: 2nd snake: Woma or Western Hognose?
 Originally Posted by piedlover79
I love my hognose SO much!! He's my favorite snake of five species (ball, corn, rat, sand, hog). He has attitude but doesn't bite, his face is adorable, he super easy to feed, he fasts in the winter making him a cost free pet while bruminating, never has shed issues, just all around a wonderful snake to own.
How can you resist that face?

What a beautiful animal! And that face 😍

Bri 
-
-
Thank you! He's a red anaconda hognose.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|