Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 634

0 members and 634 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,916
Threads: 249,118
Posts: 2,572,199
Top Poster: JLC (31,651)
Welcome to our newest member, Wilson1885
Page 3 of 3 FirstFirst 123
Results 21 to 26 of 26
  1. #21
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Help me find a morph! - Blacks/greys/whites maybe?

    Quote Originally Posted by JodanOrNoDan View Post
    I currently have three adult white breeders. A Spider Super Mojave, a Lesser/Mojave, and an Ivory. I have had them since they were a year or less old and their color has not changed. The Super Mojave's degree of white changes according to where he is in his shed cycle. He get's "dirty" when close to shedding. The other two do not. My purple passions do not get "dirty" either.
    Quote Originally Posted by HannahLou View Post
    I own many BEL morphs and in my experience the super lessers and lesser/mojaves are the only ones I've seen that can maintain pure white as adults. I've heard people say super russos are whitest but mine has yellow and any other one I've seen has faint yellow pattern too. I shared her in a black Light thread before I can try to dig up.

    Interesting... Every adult BluEL I have encountered has been more of a cream-coloured than pure white.

    Here is my holdback female SuperFire possible Pastel, possible SuperPastel, possible Yellowbelly. She is going into a shed cycle so she has a bit of a pink flush to her right now
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. #22
    BPnet Royalty Zincubus's Avatar
    Join Date
    02-22-2011
    Posts
    7,008
    Thanks
    2,526
    Thanked 4,965 Times in 3,027 Posts

    Re: Help me find a morph! - Blacks/greys/whites maybe?

    I may start a new thread and include a poll to asertain which morph gives the whitest adults - just thinking what to call the thread !?!


    Any suggestions ??




  3. #23
    Registered User
    Join Date
    02-27-2017
    Posts
    33
    Thanks
    2
    Thanked 4 Times in 4 Posts
    I got a reply from Exeter Exotics and they have the following snakes I so wish I had the spare cash right now, but having just bought a new car ( '17 370z Nismo if anyone is into cars ) I'm a bit on the low side for disposable cash

    They have :
    a Breeder Size Male GHI Mojave for £685.
    a 2016 Hatchling Blue Eye Lucy (Super Lesser)... pure white, £250.And lastly I have just also got in another Lucy, again pure white, but it is a GHI Lesser Russo. The eye colour is more of a greyish blue. Again this is a 2016 baby Male... I have just got to work out the price on him but he will be closer to the price of the GHI Mojave.

    It seems fairly priced to me, I just cant believe they are all male I just have to hope that Nox is female hahaha or keep the search going ^_^

    I would have asked for pics, but I have no intention of going ahead with the sale at this point, I'd need to get a 2nd tank set up and also look into more things I might need in the future. Rather pamper one snake than have 2 neglected beauties.

  4. #24
    Registered User
    Join Date
    04-24-2017
    Posts
    11
    Thanks
    28
    Thanked 12 Times in 6 Posts

    Re: Help me find a morph! - Blacks/greys/whites maybe?

    Quote Originally Posted by kxr View Post
    Is this black enough for you?

    http://www.worldofballpythons.com/mo...uper-mahogany/

    I really like that one myself. I can see quite a bit of potential there if they are all consistently that dark and maintain that into adulthood.
    Wow, that's beautiful. It'd be cool if they start popping up for sale in a few years, obviously they'd be very expensive but I think they'd be highly sought after.

  5. #25
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Help me find a morph! - Blacks/greys/whites maybe?

    Quote Originally Posted by Linkin View Post
    Wow, that's beautiful. It'd be cool if they start popping up for sale in a few years, obviously they'd be very expensive but I think they'd be highly sought after.
    One sold at March 2016 Tinley... $4000
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  6. #26
    BPnet Senior Member Hannahshissyfix's Avatar
    Join Date
    07-14-2015
    Posts
    1,283
    Thanks
    598
    Thanked 1,390 Times in 619 Posts

    Re: Help me find a morph! - Blacks/greys/whites maybe?

    Quote Originally Posted by asplundii View Post
    One sold at March 2016 Tinley... $4000
    I'm pretty sure Justin kobylka still has one for either 4000 or 4500 currently.

Page 3 of 3 FirstFirst 123

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1