» Site Navigation
1 members and 1,914 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,049
Threads: 249,209
Posts: 2,572,709
Top Poster: JLC (31,651)
Welcome to our newest member, Mikvik
|
-
Registered User
Help me find a morph! - Blacks/greys/whites maybe?
Hi guys, as some of you know I got my first ball python at the end of Feb this year. Called him/her Noctis due to being nocturnal and being a nerd I love him/her, he/she is roughly 6 months old now but I haven't had him/her sexed. I will do this later, perhaps when he/she turns 1? Is there a certain age to wait for?
Anyways heres some pics, maybe you can identify what Morph it is, I was told its a LesserBee or a SuperBee?? don't know but I'm happy. Comes across more yellow in the pics than he is
I just want to get another that is almost polar opposite. So darker colours like blacks/greys/whites



I saw a picture of the "stormtrooper" BP but the price is just silly money. COOL THOUGH!
The first one that caught my eye is this ( Super mahogany?? ) http://pin.it/h4np5dN - I think the colours are so radical, it's cool! My question is, how rare are they, what sort of prices am I looking at? Also will they stay black? I read about browning and it makes me worried I'd not be as "wowed" by him/her
I then found this Black Pewter - http://pin.it/OLIcqom - I like the colour combo's but I worry about browning? I don't know how dramatic it really is, but hey.
What do people think of Blue/Black eyed Lucy's? They seem totally cute but not really tooooo different to Nox - If I did get a white BP it would have to be PURE white, no yellow bits or anything, is there such a morph?
Or a black axanthic? they look so aggressive but being BP its like a puppy
Anyways heres the last link for "reference" of what sort I'm looking at, I'm sorry for the rambling unstructured post. http://jdconstriction.com/collection/
Am I being unrealistic? I have no idea about pricing and other issues but hey, no harm in asking right? Do any morphs have issues over other morphs?
Again, sorry for the miss jointed post, I tend to ramble.
-
-
Registered User
Re: Help me find a morph! - Blacks/greys/whites maybe?
This is what I'm after if it was a BEL - blue or black eyed
http://s218.photobucket.com/user/abi...elucy.jpg.html
NOT keen on these BEL's
http://s218.photobucket.com/user/abi...dlucy.jpg.html
They just seem dirty and unhealthy to me? I'm sure its a beautiful snake, but not for me unfortunately. Just trying to clarify for people
-
-
If you want an all white snake a lesser mojave is probably your best bet
-
The Following 2 Users Say Thank You to JodanOrNoDan For This Useful Post:
Dezoruba (04-24-2017),RoflOnMyWaffle (04-24-2017)
-
Re: Help me find a morph! - Blacks/greys/whites maybe?
-
The Following 2 Users Say Thank You to ladywhipple02 For This Useful Post:
Dezoruba (04-24-2017),RoflOnMyWaffle (04-24-2017)
-
Registered User
Re: Help me find a morph! - Blacks/greys/whites maybe?
-
-
Re: Help me find a morph! - Blacks/greys/whites maybe?
I think the Siren is a good looking "darker morph" - it's a Cinnamon Huffman: http://www.morphmarket.com/us/search...y=&layout=grid
The Black Pearl too (though I didn't find any on Morphmarket) - Black Pastel/Huffman: http://www.worldofballpythons.com/mo...astel-huffman/
Price is dictated by availability, typically, and there just aren't that many of the darker morphs around. I'm a fan too, though, and have done some searching myself. Just gotta keep saving lol
Last edited by ladywhipple02; 04-24-2017 at 10:50 AM.
-
-
Registered User
Re: Help me find a morph! - Blacks/greys/whites maybe?
I like both of those, do you know if they will stay black/dark? I'm not a fan of brown snakes
Also your avatar is amazing Toothless is my fave.
-
The Following User Says Thank You to RoflOnMyWaffle For This Useful Post:
ladywhipple02 (04-24-2017)
-
It is possible to get a really white BlkEL

This guy is a SuperFire possible Pastel, possible SuperPastel, possible Yellowbelly and he only had a tiny yellow spot on him by his head. His sister is pristine white. I am fairly certain it is down to both of them carrying at least one copy of the Pastel gene which seems to up the white factor on BlkELs
You can also try finding a SuperLemonback or SuperSauce as they both seem to generate high/all white BlkELs.
As for dark stuff... GHI Mojave and GHI BlkPastel might be a little more in your price range.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Registered User
-
-
Just an additional comment. I have not seen a ball yet that I consider a true black. There are balls that have true black in their pattern but not covering the entire body. Once again, lesser /mojave and lesser/ lesser are white. The other bell complex animals often have a yellowish hue and or have some yellow dorsal striping. The white of the white will be an albino lesser/mojave but this will of course have red eyes.
The black eyed white snakes are hit and miss with the total amount of pure white. I have an Ivory that is more white than my super mojave but I have seen plenty of Ivories with quite a bit of pigment. I have seen very white super fires but it is not odd to have orange on those animals as well.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|