Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 684

1 members and 683 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

» Stats

Members: 75,945
Threads: 249,139
Posts: 2,572,328
Top Poster: JLC (31,651)
Welcome to our newest member, SONOMANOODLES
Results 1 to 10 of 23

Thread: Type of ghost

Threaded View

  1. #15
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Type of ghost

    Quote Originally Posted by locolobito View Post
    Vespers led me to the yellow ghost. And at this moment the searches on yellow ghost matches my girl.
    And yet YellowGhost is compatible with OrangeGhost and so we can say for a fact that, regardless of whatever pictures you are looking at, your animal is not a YellowGhost because when bred to an OrangeGhost you did not get visuals

    Quote Originally Posted by locolobito View Post
    I talked to Graziani and he told me pattern does not match his line.
    While I have much respect for Greg he does occasionally make mistakes. The pattern in balls is widely variable and so a G1 from someone else's collection that had been out crossed could very likely have patterning different from the animals in Greg's collection.


    So again, if you want to truly determine just what type of Hypo you have you are going to have to test by breeding. We can eliminate the most common lines of Hypo (Orange, Yellow, Peach, Butterscotch, Green, Bell, NERD, etc.) because they are all compatible. That leaves you with G1, G2 and GCR
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    PokeyTheNinja (04-26-2017)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1