» Site Navigation
0 members and 644 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,909
Threads: 249,108
Posts: 2,572,139
Top Poster: JLC (31,651)
|
-
The PurplePassionPied will be a solid white snake and with have microphthalmia
http://www.reptileradio.net/showthre...908#post934908
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 2 Users Say Thank You to asplundii For This Useful Post:
Slowcountry Balls (03-18-2017),Trisnake (03-17-2017)
-
edit ignore me am being a spoon!
Last edited by embrit345; 03-17-2017 at 09:01 AM.
-
-
Re: purple passion pied?
 Originally Posted by embrit345
Cancel my last statement!!!!
So my hubby and I "adopted" some young American air men and woman who are stationed at one of our local bases here i the UK. 13 of them to be exact lol
They just all messaged me a happy happy early mothers day and have chipped in together and bought me a pied male!!!!!!
I am gonna call him USAF heheh xx
Pics will follow once I figure out how to get tapatalk on my mobile again so I can do them from there xx
Awww that's so awesome! Congrats!
-
The Following User Says Thank You to Lizardlicks For This Useful Post:
-
Re: purple passion pied?
 Originally Posted by asplundii
Welp.... a bit of a let down but exciting stuff to discover I guess. Genetics will forever fascinate me.
I do wish the links to the images of the passion pied and passion het pied were still valid.
-
The Following User Says Thank You to Trisnake For This Useful Post:
-
Re: purple passion pied?
 Originally Posted by Lizardlicks
So for a while I was hitting a recursive google image search loop where it points me to pintrest and pintrest lists the source as google image search  The only pic that looked like it might be pied was this one, but reverse image search showed that was actually a super cinny with a ringer produced by Markus Jayne
No entry on WoBP either, and I don't know of anyone on specific who's working toward that combo, so my best guess is you can't find it because no one has produced it, or if they have they haven't said anything about it.
I think that might be one of Brandon Osborne's Urban Camo animals (https://ball-pythons.net/forums/show...EADY-TO-BREED!)
 Originally Posted by asplundii
You beat me to it Travis! When I saw the title of this thread I thought of the Mystic Potion Pied that Adam and Lisa from the Herp Vault produced.
-
The Following 2 Users Say Thank You to Slowcountry Balls For This Useful Post:
asplundii (03-20-2017),embrit345 (03-20-2017)
-
I work mostly with pied combos and some combos are pretty much 'dead ends' as far as changing the color of the snake. Once you get to an all white snake you can add just about anything else and it won't change much. However, once you get to that point they are genetic powerhouses and will pop out all kinds of combos from one snake. There are some combos I'm avoiding like Bamboo pieds, not much pattern left there. And anything that changes the pattern such as Leopard Pied, you really can't tell if it's Leopard since the pied gene jumbles the patterns anyway in most cases. Right now I'm working with Pied + albino, pinstripe, fire, pastel, coral glow, and spider. I'd love to jump into the black pastel and go for the super black pastel pied (Panda Pied). I still don't have Mojave pied, I may pick one of those up next... I also have my own pet project, I'm trying to make a Super Jungle Woma pied (Puzzleback Pied) from scratch, I'm hoping to get there first for the 'World's First'! Still have a few years to go!
Super Jungle Womas:
Last edited by cchardwick; 03-18-2017 at 10:55 AM.
-
The Following 3 Users Say Thank You to cchardwick For This Useful Post:
embrit345 (03-20-2017),JodanOrNoDan (03-18-2017),Lizardlicks (03-18-2017)
-
Re: purple passion pied?
 Originally Posted by cchardwick
I work mostly with pied combos and some combos are pretty much 'dead ends' as far as changing the color of the snake. Once you get to an all white snake you can add just about anything else and it won't change much. However, once you get to that point they are genetic powerhouses and will pop out all kinds of combos from one snake. There are some combos I'm avoiding like Bamboo pieds, not much pattern left there. And anything that changes the pattern such as Leopard Pied, you really can't tell if it's Leopard since the pied gene jumbles the patterns anyway in most cases. Right now I'm working with Pied + albino, pinstripe, fire, pastel, coral glow, and spider. I'd love to jump into the black pastel and go for the super black pastel pied (Panda Pied). I still don't have Mojave pied, I may pick one of those up next... I also have my own pet project, I'm trying to make a Super Jungle Woma pied (Puzzleback Pied) from scratch, I'm hoping to get there first for the 'World's First'! Still have a few years to go!
Super Jungle Womas:

I just jumped into panda pieds with my purchase of a black pastel het pied and pied pair. I'm both super scared and super excited for it.
Sent from my SAMSUNG-SM-N920A using Tapatalk
-
The Following User Says Thank You to Dezoruba For This Useful Post:
-
I may be after a panda- male black pewter het pied, female black pastel champagne POS het pied. Also have my killer pied POS Leopard female for good measure
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|