Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 874

1 members and 873 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,908
Threads: 249,107
Posts: 2,572,125
Top Poster: JLC (31,651)
Welcome to our newest member, KoreyBuchanan
Results 1 to 5 of 5
  1. #1
    BPnet Veteran OTorresUSMC's Avatar
    Join Date
    06-08-2016
    Location
    Upstate NY
    Posts
    307
    Thanks
    129
    Thanked 96 Times in 72 Posts
    Images: 2

    Chimera: super stripe Ivory

    I am going to reference the super stripe Ivory only because this is what made me think of the question. Dont know if you have seen it or not but this is a chimera produced by santana's spectrum reptiles. I know other chimeras have also been produced. My question is can these snakes then pass on all of these genes? To clarify a regular superstripe has specter YB and can only pass on one as those genes sit on the same locus. with this snake clearly having something different going on could it pass on both genes? or with this specific animal two YB genes? Could it, bred to a normal, produce a superstripe or an ivory? Im asking this because I am assuming to show both features this snake would have to have one locus with two YB genes and one with YB/specter right? or am i just wayyyyyyyyyy off?
    0.1 Woma Pinstripe "Gemma"
    0.1 Ultramel "Lyla"
    0.1 Bamboo Woma "Tara"
    0.1 Rio(Super Arroyo) "Wendy"
    1.0 Clown "Happy"
    1.0 Pastel Butter Ghost "Unser"
    1.0 KillerBee Yellow Belly "Half-Sack"

  2. #2
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    Can these animals pass on all the genes in them? Yes and no. But not in the manner you are talking about.

    The genotype of the gametic tissue will dictate which genes are passed along. So let us say you have a male chimera. If both of his testes are derived from tissue that is genetically SuperStripe then he will produce like a SuperStripe (i.e., half his offspring will be YB and the other half will be Specter.) If both of his testes are derived from tissue that is genetically Ivory then he will produce like an Ivory (i.e., all offspring will be YB.) Now, if one of his testes is derived from tissue that is genetically SuperStripe but the other is derived from tissue that is genetically Ivory then he will produce like an off kilter SuperStripe (i.e., one quarter of his offspring will be Specter and the other three quarters will be YB.)
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  3. The Following User Says Thank You to asplundii For This Useful Post:

    OTorresUSMC (01-30-2017)

  4. #3
    BPnet Veteran Izzys Keeper's Avatar
    Join Date
    09-21-2009
    Posts
    525
    Thanks
    2
    Thanked 190 Times in 116 Posts

    Re: Chimera: super stripe Ivory

    Basically in a chimera the way I understand it, the genitals will be one morph or the other. In the case of a superstripe, (which is not an example of a chimera btw) the animal will have both the yb and specter gene available to pass down, but will only pass 1 or the other with 50% percent chance for each

    Sent from my SM-G935T using Tapatalk

  5. #4
    BPnet Veteran Izzys Keeper's Avatar
    Join Date
    09-21-2009
    Posts
    525
    Thanks
    2
    Thanked 190 Times in 116 Posts

    Re: Chimera: super stripe Ivory

    Think of a chimera as 2 babies that fused into 1 in the egg very early on. 1 of those babies will be responsible for the genitals of the chimera and that will be the one that will pass on its genetics

    Sent from my SM-G935T using Tapatalk

  6. #5
    BPnet Veteran
    Join Date
    08-29-2006
    Posts
    311
    Thanks
    96
    Thanked 191 Times in 108 Posts
    You misread- superstripe ivory. Try again.

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1