Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 686

1 members and 685 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

» Stats

Members: 75,945
Threads: 249,139
Posts: 2,572,328
Top Poster: JLC (31,651)
Welcome to our newest member, SONOMANOODLES
Results 1 to 10 of 31

Thread: White Morphs

Threaded View

  1. #31
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts


    SuperFire possible Pastel, possible SuperPastel, possible YB. He has a small spot of yellow on the back of his head, maybe ten scales total. His sister is pristine white
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    jkerezsi (12-05-2016)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1