Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 883

0 members and 883 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,905
Threads: 249,107
Posts: 2,572,120
Top Poster: JLC (31,651)
Welcome to our newest member, Pattyhud
Results 1 to 5 of 5
  1. #1
    Registered User spygirl's Avatar
    Join Date
    07-02-2008
    Location
    Austin, TX
    Posts
    137
    Thanks
    33
    Thanked 37 Times in 29 Posts

    Valley Fever in dogs?

    This may be a long shot, but has anyone dealt with Valley Fever in their dog? I'm looking for owners with experience with this.

    Thanks!
    *Micah*
    My blog

  2. #2
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    I do not have first hand experience but I know a bit about the disease and I might be able to point you to some resources.

    Am I correct in assuming your dog has acquired the infection?
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  3. #3
    Registered User spygirl's Avatar
    Join Date
    07-02-2008
    Location
    Austin, TX
    Posts
    137
    Thanks
    33
    Thanked 37 Times in 29 Posts

    Re: Valley Fever in dogs?

    Yes he does. He was diagnosed roughly 5 months ago. He was doing well, then declined, then started doing well again. Now he's having more pain and I suspect his back and neck are infected. What I'm wondering is, does it get worse before it gets better? I also think he's been infected 2 years before we found he was sick. I'm just wondering if this makes recovery possible at all.

    He was infected while at his previous home, so the vets in my area have never seen a case of Valley Fever. We're consulting research and specialists, but I'll take all the help I can get.
    *Micah*
    My blog

  4. #4
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    Just so I am sure we are both talking about the same thing (because there are a couple other things called Valley Fever) the diagnosis was Coccidioidomycosis?


    Best resource for you would probably be the CDC page: http://www.cdc.gov/features/valleyfever/

    University of Arizona also has a decent page: https://www.vfce.arizona.edu/ValleyFeverInPets/


    As I said, I do not have first hand experience with the infection in dogs and it has been quite some time since I have done any pathogenic fungi work. That said, the information I can offer you is not much more than the above pages can provide. It is a fungal infection that is sometimes self-limiting but other times requires treatment. Because it is a fungal infection it can be difficult to treat and the treatment course tends to be extended. There is a fairly high incidence of relapse and usually treatment of a relapse is even longer than initial treatment. Some relapses become chronic persistent and will require lifetime treatment.

    Based on what you have said it sounds as if your dog may have had a relapse. I would discuss with this possibility with your vet and if he agrees that that is the case and you need to begin treatment again I would advocate using a different anti-fungal than the one used in the first treatment (that way you avoid the chance of creating a resistant strain).

    Your vet should be able to offer you good options on prognosis and treatment.

    I hope the best for you
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  5. #5
    BPnet Veteran Blitzjg's Avatar
    Join Date
    07-01-2013
    Location
    Detroit, MI
    Posts
    234
    Thanks
    20
    Thanked 12 Times in 9 Posts
    My mom dealt with it more than I did, but I know first-hand it takes a severe toll on the animals. Treatment is usually not very effective and it is a chronic infection that isn't going away, although it may get better at times.

    1.0 Link, my Abbott Okeetee corn snake
    1.0 Pit, my Yellow-belly ball python
    1.1 Ramza and Midna, my kittens

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1