» Site Navigation
0 members and 919 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,067
Threads: 249,217
Posts: 2,572,782
Top Poster: JLC (31,651)
|
-
BPnet Veteran
There might be some value to doing a study. There may be some correlations out there that equal more/less wobble/corkscrew. High white vs. low white. Variations in head pattern. Reduced spider. How it interacts with other genes.
I believe if someone were to do a study (not with their own snakes but with volunteers sending in photo of snakes with questionare). We are talking thousands of spiders/combos out there. The big the number, the better the data.
It would be an ambitious project and it might produce usable results.
-
-
Registered User
Re: Spider Head Wobble Please Read
 Originally Posted by DestinyLynette
Wow really? That bad? I have a spider-ghost project in mind because I adore hypo queen bees.
OP: I also read that some spiders with little or no wobble as babies sometimes grow into having wobbles as adults, or vice versa, they could grow out of it... seems impossible to monitor unless you're willing to keep every spider you'll produce through its life. Some have conditional wobbles... like my bee; I only notice he has a wobble when he's excited, typically when I feed him- he usually misses once or twice before he gets it, or I also notice he takes a while to "focus" on the mouse. He tends to stare it down and let it walk literally right by his nose for about five or more minutes before he finally decides to strike. By contrast, I put a mouse in with my normal, and BOOM, fatality.
Of course, he may get a worse wobble when he's older... but maybe not. We only know with time.
On a slightly different but still relevant note, I read spider x spider babies have 25% fatality rate. Is this true?
I bought my spider this past September, she had no visible wobble other then a slight head tilt when feeding, she was just over 150g when I got her. Now pushing 400g she has a definite wobble. I don't know about all spiders, but I have heard of a few others who get worse with size/age.
Last edited by PiercingPrincess; 07-12-2013 at 04:40 PM.
27 'Kids' and counting
-
-
Re: Spider Head Wobble Please Read
 Originally Posted by asplundii
Hey OWAL,
Not really epigenetics or multiple loci as those are specific interactions and this is more a matter of general interactions. Let me try explaining by an analogy;
You are standing on a third floor balcony with two water balloons, one is filled with red paint and one is filled with yellow paint, and you want to drop them to make mark on the pavement that is 1.5m long in the pattern 0.5m red/0.5m orange/0.5m yellow. What are the odds you can do that exactly perfect every single time? You cannot. You probably cannot even do it perfect once. Now ask yourself why. Maybe you mixed your paints slightly differently from one another... Maybe you filled the balloons with different volumes... Maybe the rubber in one balloon is slightly different than the rubber in the other causing it to pop differently... Maybe you dropped one balloon a half a second before the other... Maybe there was a gust of wind... Maybe a car drove by and hit the balloons... All these and more, factors you cannot control, are going to influence the final outcome. In the end you will still end up with a red/orange/yellow mark on the ground, but the odds are phenomenally against you that it will be the perfectly lined up one you wanted. And even if you did manage to get that mark once, making it a second time would be a feat.
It is the same with Spider and wobble. There are so many variables that the odds of hitting the perfect balance of them is closer to the none side of slim and none. And doing it repeatably is wholly improbable
I see genetics as little more controlled. But in terms of genetics, once you hit the "perfect" you should be able to more closely reproduce it and even the "non-perfects" should be able to move you closer to the "perfect". Isn't that what selective breeding is? So what have we seen to say spider is different and it just can't happen? Perhaps using your analogy, once I hit a certain goal, I am able to move down a floor where I might reproduce it more easily, maybe not perfect, but closer to perfect than previously.
side note, BH and spider potentially being on the same locus is very interesting. Good news imo.
Last edited by OhhWatALoser; 07-12-2013 at 05:38 PM.
-
-
 Originally Posted by OhhWatALoser
I see genetics as little more controlled.
Okay, this is going to be a little complex... Let me see if I can articulate this coherently.
Yes, genetics is controlled in as much as if genes are turned on/off, when genes are turned on/off, where genes are turned on/off, how long genes are turned on/off, whether genes are expressed at "high" or "low" levels, etc. But... It is not like, say, a traffic light where there are only three absolute states: "Stop" (OFF), "Yield" (LOW EXPRESSION) and "Go" (HIGH EXPRESSION). Instead, the genes have more of a plastic expression; a gene that is "off" might still occasionally be transcribed, so sticking with the traffic analogy we will say 0-8 kph, a low expression gene then would be anything from 5-50 kph and a high expression gene would be anything from 40-120 kph.
Hypothetically let us say "wobble" is the result of two gene products interacting where the wobble phenotype gets worse when there is less interaction between the two products. We will say the Spider gene is a high expression gene and the other gene is low expression.
Now, turn this into a 'You have two trains' type problem: The products are only generated for one hour and they are 90km apart. Tell me, does your Spider wobble? You cannot say really. If both genes were on the low end of their respective expression curves then it would be a terrible wobbler. If the low expression gene was at the high end but the high expression gene was at the low end then there would be some interaction but not a lot so you would have a bit of a wobble. IF both genes were expressed in the middle of their range then there would be a minor wobble and if both genes were expressed at their highest levels then it would be wobble-free.
Simple when it is just a pair-wise interaction. However, pair-wise interactions are rather rare in the genetic scheme of things: The reason we see a range for both genes is because each gene has, say, three other gene products that exert some type of regulatory effect on it. Now you have eight-tier interaction... And if each of the six genes from the prior set also has some number of gene products regulating it... The network gets more and more complex.
 Originally Posted by OhhWatALoser
But in terms of genetics, once you hit the "perfect" you should be able to more closely reproduce it and even the "non-perfects" should be able to move you closer to the "perfect". Isn't that what selective breeding is?
Just because you hit the "perfect" does not necessarily mean you can continue to do so using that animal. Yes, selective breeding works along the lines of trying to shore up the positive side of what you are looking for but if the network is too complex the balancing act becomes difficult.
 Originally Posted by OhhWatALoser
So what have we seen to say spider is different and it just can't happen? Perhaps using your analogy, once I hit a certain goal, I am able to move down a floor where I might reproduce it more easily, maybe not perfect, but closer to perfect than previously.
I get what you are saying and this is a bit where the analogy breaks down, because of the linear way you are thinking about it but, how would moving down one floor really help? Your actions are still being impacted by everything from the floor above. Yes, maybe you have reduced the amount of time that the wind is influencing your balloons as they fall but has your moving floors changed any differences in the rubber between the balloons? Or slightly different amounts of paint in the balloons? Or mistakes while mixing the paints? Those things will still act to skew your end result and are wholly independent of what floor you are on.
You also have to consider that moving down, in and of itself, will have an impact because maybe now your balloons will not get up enough speed to pop when they hit the ground...
 Originally Posted by OhhWatALoser
side note, BH and spider potentially being on the same locus is very interesting. Good news imo.
This is an interesting possibility. I still think it needs some investigation but it is a tantalizing idea.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 4 Users Say Thank You to asplundii For This Useful Post:
Beto510 (07-14-2013),eatgoodfood (07-15-2013),Inarikins (07-15-2013),MarkS (07-15-2013)
-
Spider Head Wobble Please Read
Awesome write up!! Very clear and concise. Are you a professor/teacher, by chance? Those are the only people that seem to have mastered the art of analogies, in my experience Thank you!
-
-
Re: Spider Head Wobble Please Read
 Originally Posted by MootWorm
Awesome write up!! Very clear and concise. Are you a professor/teacher, by chance? Those are the only people that seem to have mastered the art of analogies, in my experience  Thank you!
Ta, Moot.
I am not a prof/teacher (but I did four years as a professional tutor back in the dark ages of my undergrad.) I work in the field of genetics and often have found myself having to try and explain aspects of it to people who are not as familiar with it as I am. These occurrences have shown me how terribly confusing some of these concepts can be (heck, sometimes I even get confused) so I have worked at trying to find ways of explaining that put these odd concepts into terms people outside the field can more easily understand.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 4 Users Say Thank You to asplundii For This Useful Post:
eatgoodfood (07-15-2013),Inarikins (07-15-2013),MarkS (07-15-2013),MootWorm (07-15-2013)
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|