Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,627

0 members and 1,627 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,085
Threads: 249,226
Posts: 2,572,837
Top Poster: JLC (31,651)
Welcome to our newest member, FrancesMcGrowdie
Page 4 of 6 FirstFirst 123456 LastLast
Results 31 to 40 of 56
  1. #31
    BPnet Veteran
    Join Date
    04-03-2007
    Posts
    712
    Thanks
    0
    Thanked 303 Times in 187 Posts

    Too me, Spiders are like Caramels.

    Both have issues and both have decent replacements. If you like Spiders, chances are you like cool patterns so you might like the Pin. If you like Caramels, you have a good substitute without all the kinking issues in the Ultramel. I do not care one way or the other what you keep, could honestly care less, but train wrecks suck. I was just pointing out an option to keep others from the heartache of expensive train wrecks. Keep making your Bumble Bees, Spider x Pastel, what an inventive combo...I am not trying to steer you away if you LOVE spiders, just if you are on the fence about what to get....the Spider might not be the best choice if you are breeding Balls.

    Dave
    Last edited by EmberBall; 07-07-2013 at 11:52 AM.

  2. #32
    BPnet Senior Member Bluebonnet Herp's Avatar
    Join Date
    05-28-2012
    Location
    Helotes, TX
    Posts
    1,161
    Thanks
    1,405
    Thanked 476 Times in 316 Posts

    Re: Spider Head Wobble Please Read

    From what I've heard, spider x spider breeding, which has been claimed to be done and is not fatal, produces some bad wobbles, and I find that theory quite plausible. That said, the spider wobble is often not extreme, and some spiders are known to never have it. (On noticeable scale, anyway.)

  3. #33
    BPnet Veteran
    Join Date
    04-03-2007
    Posts
    712
    Thanks
    0
    Thanked 303 Times in 187 Posts

    Spiders are not the only wobblers.

    Some Champagnes wobble, although the one I have is flawless. I am not sure if it is because he is a Pastel Champagne or if I got lucky. I will be hatching some Champagnes soon, so that should let me know the extent of the wobbling in Champagnes. I know the Super Sable is supposedly a wobbler. I would not breed Sables, Spiders or Champagnes together. The Super Champagne seems to be a lethal Super.

    Dave

  4. #34
    West Coast Jungle's Avatar
    Join Date
    11-07-2006
    Location
    Los Angeles
    Posts
    8,184
    Thanks
    624
    Thanked 1,370 Times in 943 Posts
    Images: 43
    If you like the spider pattern but worry about wobble(I don't) then try Womas. They are IMO the closest thing to a spider

  5. #35
    BPnet Veteran Inarikins's Avatar
    Join Date
    11-24-2011
    Location
    Western SD
    Posts
    1,067
    Thanks
    301
    Thanked 296 Times in 213 Posts
    I was under the impression that Womas wobbled as well? Maybe I heard that somewhere or I just came up with it on my own...
    Black Pewter het Hypo Vestris; Black Pastel Enchi Zamira; Black Pastel Cheryn; Hypo Enchi Sofia; Lesser Pastel Eren; Super Mojave ???; Piebald Mako; Fire Vin; Pastel Estelle; Spider Hanji, Ezri; Normal Angelina, John, Aradia; Mojave Joe; Anerythreustic Kenyan Sand Boa ???; German Shepherd Dog Atticus; Rats Snowman, Colette, Calliope, Eliza, ???, ???

  6. #36
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    Quote Originally Posted by OhhWatALoser View Post
    In my dumb down understanding, epigenetics and multiple loci basically? Wouldn't it be reasonable to think at some point, it could be selectively reduced to some extent? I mean I understand there are even factors outside of genetics that can even effect genetics, asplundii we have talked enough were I think you know what I understand. I see there is an accepted word of mouth that it is completely random because "many have tried." There seems to be very little data on what the many tired to do exactly. I mean I'm guilty of the just accept it, everyone says so. Now I am questioning it, is it really even correct to say It can't be reduced? Obviously the things effecting it could just be too complex and appear random, but what do we really have to go on to say random, end story?
    Hey OWAL,

    Not really epigenetics or multiple loci as those are specific interactions and this is more a matter of general interactions. Let me try explaining by an analogy;

    You are standing on a third floor balcony with two water balloons, one is filled with red paint and one is filled with yellow paint, and you want to drop them to make mark on the pavement that is 1.5m long in the pattern 0.5m red/0.5m orange/0.5m yellow. What are the odds you can do that exactly perfect every single time? You cannot. You probably cannot even do it perfect once. Now ask yourself why. Maybe you mixed your paints slightly differently from one another... Maybe you filled the balloons with different volumes... Maybe the rubber in one balloon is slightly different than the rubber in the other causing it to pop differently... Maybe you dropped one balloon a half a second before the other... Maybe there was a gust of wind... Maybe a car drove by and hit the balloons... All these and more, factors you cannot control, are going to influence the final outcome. In the end you will still end up with a red/orange/yellow mark on the ground, but the odds are phenomenally against you that it will be the perfectly lined up one you wanted. And even if you did manage to get that mark once, making it a second time would be a feat.

    It is the same with Spider and wobble. There are so many variables that the odds of hitting the perfect balance of them is closer to the none side of slim and none. And doing it repeatably is wholly improbable


    Quote Originally Posted by West Coast Jungle View Post
    If you like the spider pattern but worry about wobble(I don't) then try Womas. They are IMO the closest thing to a spider
    Quote Originally Posted by Inarikins View Post
    I was under the impression that Womas wobbled as well? Maybe I heard that somewhere or I just came up with it on my own...
    Inarikins is correct, Womas also show wobble, though to a lesser degree than Spiders. But it is certainly there in the morph
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  7. #37
    BPnet Veteran majorleaguereptiles's Avatar
    Join Date
    11-18-2010
    Location
    San Diego, CA
    Posts
    391
    Thanks
    38
    Thanked 288 Times in 127 Posts

    Spider Head Wobble Please Read

    Actually, there might be a cure for spider wobble when bred to another gene.....

  8. #38
    BPnet Veteran Mrl249's Avatar
    Join Date
    03-14-2012
    Location
    San Antonio
    Posts
    1,148
    Thanks
    34
    Thanked 315 Times in 225 Posts

    Spider Head Wobble Please Read

    Quote Originally Posted by majorleaguereptiles View Post
    Actually, there might be a cure for spider wobble when bred to another gene.....
    Which gene we talkin about...

  9. #39
    BPnet Veteran majorleaguereptiles's Avatar
    Join Date
    11-18-2010
    Location
    San Diego, CA
    Posts
    391
    Thanks
    38
    Thanked 288 Times in 127 Posts

    Spider Head Wobble Please Read

    Quote Originally Posted by Mrl249 View Post
    Which gene we talkin about...
    Blackhead...

    Currently there is a group of blackhead spiders, roughly close to 15 or more.. All do not exhibit wobble, head tilt, lean... I've done neurological tests on BH Spiders vs. Spiders and other spider combos that test their motor skills. Feeding reaction, breeding reaction, upside down response, nose tap response, tall tank activity when searching for food. I've really been able to get a wobble response from every spider and spider combo Ive personally seen. Yet, there is a remarkable difference with the blackhead spider. Not to mention the Blackhead Spider looks nothing like a blackhead or a spider. Almost looks normal.... Very normal that Ralph sold one as a Normal... True story.. I referred to this in the past almost acts like a "cure" gene. As if it completes the spider...

    Now what makes it even more interesting, so far there have been 6 clutches from a BH spider and the genes acts allelic with each other... Meaning no normals were produced and you either get blackheads or spiders. Ralph Davis has hatched two BH Spider clutches this year and it has held true still....

    I know this is something that probably deserves its own thread, but it's still sort of early too hoot and hollar, but it definitely has me intrigued. I have a breeder blackhead spider male so I should find out more information on the matter soon.

    A real breakthrough? Possibly...
    Last edited by majorleaguereptiles; 07-11-2013 at 11:41 AM.

  10. The Following 3 Users Say Thank You to majorleaguereptiles For This Useful Post:

    bcr229 (07-11-2013),eatgoodfood (07-12-2013),Marrissa (07-11-2013)

  11. #40
    BPnet Senior Member
    Join Date
    09-20-2012
    Location
    Mid. TN
    Posts
    1,634
    Thanks
    404
    Thanked 1,155 Times in 615 Posts

    Spider Head Wobble Please Read

    Quote Originally Posted by majorleaguereptiles View Post
    Actually, there might be a cure for spider wobble when bred to another gene.....
    i'd like to know this as well. and i'm sure most everyone else would. unless it's a new gene that's under wraps i see no reason to keep this secret.. and if there is, why tease us??

Page 4 of 6 FirstFirst 123456 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1