Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,872

1 members and 1,871 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,067
Threads: 249,217
Posts: 2,572,782
Top Poster: JLC (31,651)
Welcome to our newest member, Inky Clouds
Page 2 of 6 FirstFirst 123456 LastLast
Results 11 to 20 of 56
  1. #11
    Apprentice SPAM Janitor MarkS's Avatar
    Join Date
    07-22-2005
    Location
    St Paul, MN
    Posts
    6,209
    Thanks
    1,535
    Thanked 2,678 Times in 1,596 Posts
    Images: 3
    Blog Entries
    9

    Re: Spider Head Wobble Please Read

    Quote Originally Posted by DestinyLynette View Post
    Wow really? That bad? I have a spider-ghost project in mind because I adore hypo queen bees.
    well, I've produced many nice spiders with no problems, but I've also produced enough that weren't quite 'train wrecks' but also were bad enough that I didn't feel comfortable selling them. So now, they're mine forever. I felt that the hand writing was pretty much on the wall and I had to ask myself just how many non productive spiders do I want to house? Realistically I probably will breed them again sometime but it would have to be a pretty interesting project. So right now they're a bunch of freeloading rat vacuums.

  2. #12
    BPnet Lifer sho220's Avatar
    Join Date
    05-04-2006
    Location
    Stoolbend, VA
    Posts
    4,924
    Thanks
    615
    Thanked 2,356 Times in 1,377 Posts
    Images: 11

    Re: Spider Head Wobble Please Read

    Quote Originally Posted by MarkS View Post
    well, I've produced many nice spiders with no problems, but I've also produced enough that weren't quite 'train wrecks' but also were bad enough that I didn't feel comfortable selling them. So now, they're mine forever. I felt that the hand writing was pretty much on the wall and I had to ask myself just how many non productive spiders do I want to house? Realistically I probably will breed them again sometime but it would have to be a pretty interesting project. So right now they're a bunch of freeloading rat vacuums.
    I think I've gotten really lucky over the years. I've only produced maybe 20 or so Spiders or Spider combos and haven't had any serious wobblers or spinners. Most show no sign of wobbling, a few showed a little. I still have several that I've raised up and none have developed any wobbling over the years. All the Spiders/Spider combos in my collection came from the same male I picked up in 2006. Producing a really bad spinner would probably horrify me and have me seriously contemplating working with them beyond that. I've seen a few spinners at shows and it's pretty sad.
    Lucifer Sam, Siam cat...
    Always sitting by your side,
    Always by your side...
    That cat's something I can't explain...

  3. #13
    BPnet Veteran Mr Oni's Avatar
    Join Date
    01-04-2013
    Location
    Upstate NY
    Posts
    634
    Thanks
    352
    Thanked 258 Times in 192 Posts

    Re: Spider Head Wobble Please Read

    Quote Originally Posted by DestinyLynette View Post


    On a slightly different but still relevant note, I read spider x spider babies have 25% fatality rate. Is this true?
    http://www.youtube.com/watch?v=uStCAKMbnqQ

    Heres 1 of 2 videos NERD has about lethal combos and they speak of spiders as well...spoiler...not lethal.
    Balls
    1.0 Bumblebee Het Ghost
    1.0 Power ball
    0.1 Fire Ghost
    0.1 Butter Pin
    Milks
    1.0 Eastern milk snake
    0.1 Extreme Hypo Honduran
    Hognose
    0.1 Western hognose Albino
    Leopard Gecko
    1.0 Sunglow


    Beware his song about big butts. He beats you up while he ppppllllaaaaysss iiiit-- Eyugh!

  4. The Following User Says Thank You to Mr Oni For This Useful Post:

    sho220 (07-03-2013)

  5. #14
    BPnet Veteran
    Join Date
    10-07-2010
    Posts
    708
    Thanks
    163
    Thanked 231 Times in 180 Posts
    Images: 10
    Personally I have yet to see a spider that does not wobble or show a tremor to some degree, if you watch closely enough. Sometimes it is very slight, and only shows up if the snake is excited. Our first spider, I swore up and down did not wobble, until someone pointed out the minor tremor that showed up at feeding. Fortunately, I have not produced any severe wobblers.

    I did have an incident where I shipped a spider that showed the typical tremor at feeding time, then had the buyer say she was a trainwreck on arrival. She was miraculously cured when I asked for a video before giving a refund, so I tend to doubt the legitimacy of that particular case, but I do believe that stress can make a "non wobbler" develop a wobble. So, I will now be providing videos of any spiders I sell, just to be safe.

  6. The Following User Says Thank You to FireStorm For This Useful Post:

    Badgemash (07-05-2013)

  7. #15
    BPnet Veteran
    Join Date
    08-31-2011
    Posts
    649
    Thanks
    193
    Thanked 428 Times in 263 Posts
    Images: 21

    Re: Spider Head Wobble Please Read

    Quote Originally Posted by DestinyLynette View Post
    On a slightly different but still relevant note, I read spider x spider babies have 25% fatality rate. Is this true?
    Maybe, and maybe not. Nobody knows. It is all guesswork. Nobody posts numbers of eggs, hatchlings, slugs, and what (if any) type of embryo is inside the slugs.

    It is well known that breeder females need higher levels of vitamins than nonbreeders. Would a vitamin supplement for the parents produce a smaller proportion of spinning spider royals? Might be worth a try.

  8. #16
    BPnet Royalty OhhWatALoser's Avatar
    Join Date
    07-28-2007
    Location
    Suburbs of Detroit
    Posts
    4,986
    Thanks
    530
    Thanked 2,721 Times in 1,477 Posts
    Images: 2
    OP I'll start by saying I agree that you will probably discover nothing new but....

    everyone seems in to agree that the variability of the wobble is all over the place and seems to show no pattern. We accept that, but why is it all over the place? This is more a question for a geneticist and not really going to be solved by simply breeding a bunch of snakes. I would have to imagine that person would need some sort of data to even begin to start thinking of possible answers to why. Epigenetic event perhaps? Another locus effecting it or multiple loci? Factors outside of genetics?

    I keep hearing that many people have tired to breed it out.... what was actually tired? Did they breed some low wobble spiders to a normal and give up or how many generation did they go before calling it quits because I have a feeling there are very few who actually have some extensive data on this. It would be interesting to hear those results.

    here is part of something I wrote a while ago you might find interesting. Still doesn't help you with your project though.
    I don't believe the wobble is going to be seperated from these morphs. There is too much evidence it is linked directly to the gene, but I think it can be reduced. I see stress levels might play a factor in the amount of wobble the Spider's show. As stated before, every snake is different, but I have personally seen how changing homes can bring a minimal wobble, to horrible wobble, to minimal wobble again. Many people report only seeing signs of it while only feeding, or only while being handled. I feel this strengthens the idea that stress or excitement can elevate the condition.

    I know this may be a touchy subject for some Wobbler owners whose snakes exhibit a particularly bad wobble. They may feel like i'm saying their not taking care of their snake correctly. I will say if your snake is eating and living a healthy life, you are doing a great job, there may be Wobblers that will always have the bad wobble, but also it may need extra accommodations beyond the normal to feel less stressed (ex. extra hide, more foliage, less direct light, ect). Yes, I am suggesting the 2 hide, water bowl, cookie cutter setup may not be right for every ball python in general and the Wobblers just shows it. I have talked this over with many people and online and I think it all comes to the same conclusion that it's near impossible to test this theory. Some people have stories that strengthen the theory and some have stories that 100% conflict with it. So take it as you wish. If you have any input on this feel free to contect me, it would be great to hear what you have to say.
    Last edited by OhhWatALoser; 07-03-2013 at 05:45 PM.

  9. #17
    Steel Magnolia rabernet's Avatar
    Join Date
    07-12-2005
    Location
    In the Nest
    Posts
    29,196
    Thanks
    2,845
    Thanked 5,584 Times in 3,092 Posts
    Images: 46
    Blog Entries
    2

    Re: Spider Head Wobble Please Read

    Quote Originally Posted by TylerWaugh View Post
    I already know this but nobody has really experimented most people are just making more and more spiders to make money and in my post I said its probably impossible so I don't need someone else saying it that has probably never tried and has just read stuff by other people who haven't tried.
    Kevin from NERD has, he's produced hundreds of them. They are all decendents from his original spider. No other spiders have ever been found in the wild.

    Sent from my Samsung Note II using Tapatalk 2

  10. #18
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Spider Head Wobble Please Read

    Quote Originally Posted by Mr Oni View Post
    Heres 1 of 2 videos NERD has about lethal combos and they speak of spiders as well...spoiler...not lethal.
    The "Invisible Cat" argument...

    Unfortunately this is yet another instance of Kevin's word being taken as gospel on a topic he does not have the proper knowledge base to be making absolute statements about.


    Quote Originally Posted by OhhWatALoser View Post
    everyone seems in to agree that the variability of the wobble is all over the place and seems to show no pattern. We accept that, but why is it all over the place? This is more a question for a geneticist and not really going to be solved by simply breeding a bunch of snakes... Epigenetic event perhaps? Another locus effecting it or multiple loci? Factors outside of genetics?
    I can answer that one for you --Stochasticity.

    The short version: Just because all Spiders have the same gene does not mean that gene is expressed in a 100% absolutely identical manner in every Spider. The variation in the expression level of the Spider gene, the interaction of the Spider gene product with other gene products, the variation in the level of expression of the genes whose products interact with the Spider gene... All these things combined act to create a spectrum of intensity of the wobble phenotype.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  11. The Following 3 Users Say Thank You to asplundii For This Useful Post:

    eatgoodfood (07-10-2013),MarkS (07-05-2013),snakesRkewl (07-07-2013)

  12. #19
    Old enough to remember. Freakie_frog's Avatar
    Join Date
    08-12-2004
    Location
    221b Baker Street
    Posts
    16,636
    Thanks
    462
    Thanked 3,884 Times in 2,148 Posts
    Images: 107
    Blog Entries
    2
    Here's going to be my recomendation. If the only way you're going to know for sure that what you're being told is the truth is to spend the next 7-20 years proving or disproving this. I say go for it, you might inadvertantly stumble on something the rest of us have over looked..and honestly good luck to you in your venture.

  13. #20
    BPnet Veteran
    Join Date
    04-03-2007
    Posts
    712
    Thanks
    0
    Thanked 303 Times in 187 Posts

    The first Spiders were sold for over $20,000.

    A friend of mine received his Spider and was floored by its condition. Imagine paying $20K cash for a snake, and when you receive it, it basically ties itself in knots over and over again. When he contacted the breeder, he said that is just what Spiders do. So, people who wanted to make their money back kept it quiet for several years. I imagine NERD did everything they could think of to breed the wobble out. My advice to people now, buy Pinstripes instead. I got rid of every spider I owned except one.

    Dave

Page 2 of 6 FirstFirst 123456 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1