Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,812

0 members and 1,812 guests
No Members online
Most users ever online was 54,199, 06-29-2026 at 02:43 AM.

» Today's Birthdays

None

» Stats

Members: 76,098
Threads: 249,244
Posts: 2,572,940
Top Poster: JLC (31,651)
Welcome to our newest member, nightfallvt
Results 1 to 6 of 6
  1. #1
    Registered User LocoKen's Avatar
    Join Date
    08-08-2012
    Location
    Bremerton, WA
    Posts
    37
    Thanks
    35
    Thanked 9 Times in 8 Posts
    Images: 8

    Super Stripe ?'s

    So, after seeing the "Marvel Ball" (or Citrus Super Stripe) on Markus Jayne's website, I decided to play around with the genetic wizard and came across something interesting. O.K. So you breed the Specter and the Yellow Belly to make the Super Stripe, right? And the Citrus Super Stripe (CSS) is a Citrus Pastel, Specter, and the YB all rolled into one. Alright. Here's where it gets strange. If you have a Super Stripe, and you breed it to the Citrus Pastel, it shows that you won't get a CSS out of that clutch. The only way to get it is to have a Citrus Pastel YB bred to the Specter. It won't work the other way around. Is this just a glitch in the genetic wizard, or is it just the way these genes work together? In other words, you have to have the YB in one parent, and the Specter gene in the other in order to produce it this way? Anyway, I love the Marvel Ball, and would love to make one some day, "Lord willing and the creek don't rise!" Just found this a little strange.
    Last edited by LocoKen; 06-15-2013 at 03:14 AM.

  2. #2
    BPnet Veteran majorleaguereptiles's Avatar
    Join Date
    11-18-2010
    Location
    San Diego, CA
    Posts
    391
    Thanks
    38
    Thanked 288 Times in 127 Posts

    Super Stripe ?'s

    Spector and YB are allelic and in the same gene complex. Meaning the homozygous form "super stripe" when bred to a normal would yield either spectors or ybs and no normals and no superstripes. Much as a ivory to normal would make all ybs and no ivory, only difference is in this case you are substituting a YB gene for a Spector gene. It works with way with all the complex mutations from blue eye lucy, black eye Lucy, black pastel complex and YB complex.

    So to make a pastel super stipe you need to cross Spector and yb together in the same pairing, with either of which having pastel as well. Hopefully this makes sense.
    Last edited by majorleaguereptiles; 06-15-2013 at 03:26 AM.

  3. The Following 2 Users Say Thank You to majorleaguereptiles For This Useful Post:

    LocoKen (06-15-2013),snakesRkewl (06-15-2013)

  4. #3
    Registered User LocoKen's Avatar
    Join Date
    08-08-2012
    Location
    Bremerton, WA
    Posts
    37
    Thanks
    35
    Thanked 9 Times in 8 Posts
    Images: 8

    Re: Super Stripe ?'s

    Never even knew about that. I'm glad there is an easy explanation for it, and I have a lot to learn. Thank you for the herpetology/genealogy lesson, MLB! Very much appreciated!

    Quote Originally Posted by majorleaguereptiles View Post
    Spector and YB are allelic and in the same gene complex. Meaning the homozygous form "super stripe" when bred to a normal would yield either spectors or ybs and no normals and no superstripes. Much as a ivory to normal would make all ybs and no ivory, only difference is in this case you are substituting a YB gene for a Spector gene. It works with way with all the complex mutations from blue eye lucy, black eye Lucy, black pastel complex and YB complex.

    So to make a pastel super stipe you need to cross Spector and yb together in the same pairing, with either of which having pastel as well. Hopefully this makes sense.

  5. #4
    Registered User LocoKen's Avatar
    Join Date
    08-08-2012
    Location
    Bremerton, WA
    Posts
    37
    Thanks
    35
    Thanked 9 Times in 8 Posts
    Images: 8

    Re: Super Stripe ?'s

    Quote Originally Posted by majorleaguereptiles View Post
    Spector and YB are allelic and in the same gene complex. Meaning the homozygous form "super stripe" when bred to a normal would yield either spectors or ybs and no normals and no superstripes. Much as a ivory to normal would make all ybs and no ivory, only difference is in this case you are substituting a YB gene for a Spector gene. It works with way with all the complex mutations from blue eye lucy, black eye Lucy, black pastel complex and YB complex.

    So to make a pastel super stipe you need to cross Spector and yb together in the same pairing, with either of which having pastel as well. Hopefully this makes sense.
    Is there someplace that has all the genes mentioned to date and what they are/are not allelic to each other? Or are the pairs you you mentioned the only ones who have these traits?

  6. #5
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Super Stripe ?'s

    Quote Originally Posted by LocoKen View Post
    Is there someplace that has all the genes mentioned to date and what they are/are not allelic to each other? Or are the pairs you you mentioned the only ones who have these traits?
    http://www.owalreptiles.com/complexes.php

    Though he is missing (in my opinion) a few morph in some of the complexes

    I would also contend that there are three or four other allele groups that he does not list. But those he does list are probably the most relevant ones
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  7. #6
    Registered User LocoKen's Avatar
    Join Date
    08-08-2012
    Location
    Bremerton, WA
    Posts
    37
    Thanks
    35
    Thanked 9 Times in 8 Posts
    Images: 8

    Re: Super Stripe ?'s

    Thank you for the reply! Sorry for the late one! You're amazing!

    Quote Originally Posted by asplundii View Post
    http://www.owalreptiles.com/complexes.php

    Though he is missing (in my opinion) a few morph in some of the complexes

    I would also contend that there are three or four other allele groups that he does not list. But those he does list are probably the most relevant ones

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1