Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 746

0 members and 746 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,912
Threads: 249,115
Posts: 2,572,187
Top Poster: JLC (31,651)
Welcome to our newest member, coda
Results 1 to 6 of 6

Hybrid View

  1. #1
    BPnet Veteran majorleaguereptiles's Avatar
    Join Date
    11-18-2010
    Location
    San Diego, CA
    Posts
    391
    Thanks
    38
    Thanked 288 Times in 127 Posts

    Super Stripe ?'s

    Spector and YB are allelic and in the same gene complex. Meaning the homozygous form "super stripe" when bred to a normal would yield either spectors or ybs and no normals and no superstripes. Much as a ivory to normal would make all ybs and no ivory, only difference is in this case you are substituting a YB gene for a Spector gene. It works with way with all the complex mutations from blue eye lucy, black eye Lucy, black pastel complex and YB complex.

    So to make a pastel super stipe you need to cross Spector and yb together in the same pairing, with either of which having pastel as well. Hopefully this makes sense.
    Last edited by majorleaguereptiles; 06-15-2013 at 03:26 AM.

  2. The Following 2 Users Say Thank You to majorleaguereptiles For This Useful Post:

    LocoKen (06-15-2013),snakesRkewl (06-15-2013)

  3. #2
    Registered User LocoKen's Avatar
    Join Date
    08-08-2012
    Location
    Bremerton, WA
    Posts
    37
    Thanks
    35
    Thanked 9 Times in 8 Posts
    Images: 8

    Re: Super Stripe ?'s

    Never even knew about that. I'm glad there is an easy explanation for it, and I have a lot to learn. Thank you for the herpetology/genealogy lesson, MLB! Very much appreciated!

    Quote Originally Posted by majorleaguereptiles View Post
    Spector and YB are allelic and in the same gene complex. Meaning the homozygous form "super stripe" when bred to a normal would yield either spectors or ybs and no normals and no superstripes. Much as a ivory to normal would make all ybs and no ivory, only difference is in this case you are substituting a YB gene for a Spector gene. It works with way with all the complex mutations from blue eye lucy, black eye Lucy, black pastel complex and YB complex.

    So to make a pastel super stipe you need to cross Spector and yb together in the same pairing, with either of which having pastel as well. Hopefully this makes sense.

  4. #3
    Registered User LocoKen's Avatar
    Join Date
    08-08-2012
    Location
    Bremerton, WA
    Posts
    37
    Thanks
    35
    Thanked 9 Times in 8 Posts
    Images: 8

    Re: Super Stripe ?'s

    Quote Originally Posted by majorleaguereptiles View Post
    Spector and YB are allelic and in the same gene complex. Meaning the homozygous form "super stripe" when bred to a normal would yield either spectors or ybs and no normals and no superstripes. Much as a ivory to normal would make all ybs and no ivory, only difference is in this case you are substituting a YB gene for a Spector gene. It works with way with all the complex mutations from blue eye lucy, black eye Lucy, black pastel complex and YB complex.

    So to make a pastel super stipe you need to cross Spector and yb together in the same pairing, with either of which having pastel as well. Hopefully this makes sense.
    Is there someplace that has all the genes mentioned to date and what they are/are not allelic to each other? Or are the pairs you you mentioned the only ones who have these traits?

  5. #4
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Super Stripe ?'s

    Quote Originally Posted by LocoKen View Post
    Is there someplace that has all the genes mentioned to date and what they are/are not allelic to each other? Or are the pairs you you mentioned the only ones who have these traits?
    http://www.owalreptiles.com/complexes.php

    Though he is missing (in my opinion) a few morph in some of the complexes

    I would also contend that there are three or four other allele groups that he does not list. But those he does list are probably the most relevant ones
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  6. #5
    Registered User LocoKen's Avatar
    Join Date
    08-08-2012
    Location
    Bremerton, WA
    Posts
    37
    Thanks
    35
    Thanked 9 Times in 8 Posts
    Images: 8

    Re: Super Stripe ?'s

    Thank you for the reply! Sorry for the late one! You're amazing!

    Quote Originally Posted by asplundii View Post
    http://www.owalreptiles.com/complexes.php

    Though he is missing (in my opinion) a few morph in some of the complexes

    I would also contend that there are three or four other allele groups that he does not list. But those he does list are probably the most relevant ones

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1