» Site Navigation
0 members and 746 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,912
Threads: 249,115
Posts: 2,572,187
Top Poster: JLC (31,651)
Welcome to our newest member, coda
|
-
Super Stripe ?'s
Spector and YB are allelic and in the same gene complex. Meaning the homozygous form "super stripe" when bred to a normal would yield either spectors or ybs and no normals and no superstripes. Much as a ivory to normal would make all ybs and no ivory, only difference is in this case you are substituting a YB gene for a Spector gene. It works with way with all the complex mutations from blue eye lucy, black eye Lucy, black pastel complex and YB complex.
So to make a pastel super stipe you need to cross Spector and yb together in the same pairing, with either of which having pastel as well. Hopefully this makes sense.
Last edited by majorleaguereptiles; 06-15-2013 at 03:26 AM.
-
The Following 2 Users Say Thank You to majorleaguereptiles For This Useful Post:
LocoKen (06-15-2013),snakesRkewl (06-15-2013)
-
Registered User
Re: Super Stripe ?'s
Never even knew about that. I'm glad there is an easy explanation for it, and I have a lot to learn. Thank you for the herpetology/genealogy lesson, MLB! Very much appreciated!
 Originally Posted by majorleaguereptiles
Spector and YB are allelic and in the same gene complex. Meaning the homozygous form "super stripe" when bred to a normal would yield either spectors or ybs and no normals and no superstripes. Much as a ivory to normal would make all ybs and no ivory, only difference is in this case you are substituting a YB gene for a Spector gene. It works with way with all the complex mutations from blue eye lucy, black eye Lucy, black pastel complex and YB complex.
So to make a pastel super stipe you need to cross Spector and yb together in the same pairing, with either of which having pastel as well. Hopefully this makes sense.
-
-
Registered User
Re: Super Stripe ?'s
 Originally Posted by majorleaguereptiles
Spector and YB are allelic and in the same gene complex. Meaning the homozygous form "super stripe" when bred to a normal would yield either spectors or ybs and no normals and no superstripes. Much as a ivory to normal would make all ybs and no ivory, only difference is in this case you are substituting a YB gene for a Spector gene. It works with way with all the complex mutations from blue eye lucy, black eye Lucy, black pastel complex and YB complex.
So to make a pastel super stipe you need to cross Spector and yb together in the same pairing, with either of which having pastel as well. Hopefully this makes sense.
Is there someplace that has all the genes mentioned to date and what they are/are not allelic to each other? Or are the pairs you you mentioned the only ones who have these traits?
-
-
Re: Super Stripe ?'s
 Originally Posted by LocoKen
Is there someplace that has all the genes mentioned to date and what they are/are not allelic to each other? Or are the pairs you you mentioned the only ones who have these traits?
http://www.owalreptiles.com/complexes.php
Though he is missing (in my opinion) a few morph in some of the complexes
I would also contend that there are three or four other allele groups that he does not list. But those he does list are probably the most relevant ones
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Registered User
Re: Super Stripe ?'s
Thank you for the reply! Sorry for the late one! You're amazing!
 Originally Posted by asplundii
http://www.owalreptiles.com/complexes.php
Though he is missing (in my opinion) a few morph in some of the complexes
I would also contend that there are three or four other allele groups that he does not list. But those he does list are probably the most relevant ones
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|