Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 588

2 members and 586 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,912
Threads: 249,115
Posts: 2,572,187
Top Poster: JLC (31,651)
Welcome to our newest member, coda
Results 1 to 8 of 8

Threaded View

  1. #6
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    I think the better answer, that no one has given, for YB is that it is a visual het form (albeit somewhat subtle) of the Ivory which is the "strongest" phenotype in the Stripe-Backed allele group (this group also contain the morphs Flare, Spark, Specter and Gravel.)
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    bcr229 (07-09-2013),rossi46 (06-14-2013)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1