» Site Navigation
2 members and 1,046 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,928
Threads: 249,128
Posts: 2,572,274
Top Poster: JLC (31,651)
|
-
-
-
Not bright enough for me. I would pass.
Ball Pythons(1)
1.0 Black Butter - Maple
0.1 Cinny - Spicy
0.1 Pastel Calico - Sage
0.1 Enchi - Willow
0.2 Pastel - Sarena, Claudia
0.1 Pinstripe Spotnose -Eve
0.1 Pastel Pied - Trinity
0.1 Lavender Albino - Zoe
0.1 Ivory - Flare
0.1 Spider - Medusa |
Ball Pythons(2)
0.1 Pastel Het Hypo -
0.1 Pastel YB - Kallisto
0.1 Lesser Bee - Kaede
0.1 Mystic Fire - Gabi
0.1 Calico -
1.0 SuperStripe -
1.0 BEL -
0.3 Mojaves -
0.2 Lessers -
0.2 Normal - |
|
Carpet Pythons
0.1 50% Diamond x 50% Jungle - Jimma
1.0 Coastal x Jungle - Java
1.0 Coastal Jaguar Ps Het Albino - Jag
1.0 Albino -
0.1 Zebra -
0.2 Red Coastals -
0.2 Red Coastal Jags -
0.1 Jag Chaos clutch -
0.1 JagSib Chaos clutch -
0.0.1 Tweener -
0.1 unknown Probable Coastal -
Retics
1.0 50% SD Amel - Pythagoras
0.2 50% SD Ps Het Amel - Bindy, Grey |
-
-
BPnet Veteran
He says it has the fader gene.
- - - Updated - - -
He says it has the fader gene.
-
-
Re: What do you guys think of this albino?
 Originally Posted by Kylegep
He says it has the fader gene.
I personally am not sold on the fader gene. It's probably just a low-contrast albino. I prefer the high-contrast, almost orange albinos so I would pass. But if you really like him, I would offer $250.
-
-
If you like it and you trust that the guy is telling the truth then go for it. $300 isn't bad for a breeder size male albino. Just keep in mind that low contrast albinos (which is what I believe this one is) seem to be harder to sell than high contrast albinos
Last edited by Wes; 06-12-2013 at 03:08 PM.
Ball Pythons(1)
1.0 Black Butter - Maple
0.1 Cinny - Spicy
0.1 Pastel Calico - Sage
0.1 Enchi - Willow
0.2 Pastel - Sarena, Claudia
0.1 Pinstripe Spotnose -Eve
0.1 Pastel Pied - Trinity
0.1 Lavender Albino - Zoe
0.1 Ivory - Flare
0.1 Spider - Medusa |
Ball Pythons(2)
0.1 Pastel Het Hypo -
0.1 Pastel YB - Kallisto
0.1 Lesser Bee - Kaede
0.1 Mystic Fire - Gabi
0.1 Calico -
1.0 SuperStripe -
1.0 BEL -
0.3 Mojaves -
0.2 Lessers -
0.2 Normal - |
|
Carpet Pythons
0.1 50% Diamond x 50% Jungle - Jimma
1.0 Coastal x Jungle - Java
1.0 Coastal Jaguar Ps Het Albino - Jag
1.0 Albino -
0.1 Zebra -
0.2 Red Coastals -
0.2 Red Coastal Jags -
0.1 Jag Chaos clutch -
0.1 JagSib Chaos clutch -
0.0.1 Tweener -
0.1 unknown Probable Coastal -
Retics
1.0 50% SD Amel - Pythagoras
0.2 50% SD Ps Het Amel - Bindy, Grey |
-
-
Re: What do you guys think of this albino?
Originally Posted by Kylegep
He says it has the fader gene.
Faded Albino... Yes
Fader (without going in to my personal opinion on "Fader") Albino... Nope
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
BPnet Veteran
What do you guys think of this albino?
Ok, I don't like buying Low quality animals, but I like to check because I am color blind. :/
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|
Reply With Quote
