» Site Navigation
2 members and 782 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,910
Threads: 249,115
Posts: 2,572,187
Top Poster: JLC (31,651)
Welcome to our newest member, coda
|
-
Registered User
Wich morphs can make a BEL?
I know about butter, lesser and mojave. But I read if i breed a Mystic to a Lesser there will be a BEL. Which other morphs carry the BEL gene?
Thanks!
Ball Python
1.3 Normal
1.0 Pastave
1.0 Axanthic VPI
1.0 Orange Ghost
1.1 Yellow Belly
0.1 Honey Bee
0.1 Bumblebee
0.1 Fire
Boa
1.0 Brazilian Rainbow Boa
CalKing
0.0.1 Stripe
0.0.1 Banana
-
-
Blue-Eye Lucy. complex
Lesser
Butter
Mojave
Het Russo
Mystic
Phantom
Mocha
Black-eye Lucy.
Fire
Sulfur
Flame
0.1 GHI Mojave
0.1 Super special h scaleless
0.1 Desert ghost
1.0 WC Dinker
-
-
Registered User
Re: Wich morphs can make a BEL?
This is based on what I have read and im not 100% on this but the following morphs are part of the BEL complex : lesser/butter, mojave, Russo, mystic, and phantom. I think that's all of them but I'm not positive someone can add on if I'm wrong ha. But mystic x mystic doesn't make a bel and phantom x mystic or phantom or mojave doesn't make a bel and same goes for mystic. But mystic or phantom by butter/lesser makes a bel.
Sent from my SCH-I535 using Tapatalk 2
-
-
The Special is in the BluEL group. The Daddy allele is also in this group but it does not make a BluEL when combined with any of the others. And according to everything I have heard the Bamboo is also in this group
And in BlkEL group you have ProExotic's Lemonback and RDR's DesertLemon and NERD's Lucifer. You also have Vanilla and Disco in this group, but they do not make a white snake when in combo with others in the group
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
I believe Ember is in the BlkEL group as well.
-
-
Don't forget the Brite, I think it is in the BlkEL group as well.
-
-
-
-
I think butter/lesser X mojave makes a very white snake.
1.0 firefly ball python
1.0 100% Pastel het clown ball python
1.0 Enchi ball python
1.0 Super Pastel 100% het pied (Richard)
0.1 Butter 100% het ghost
0.1 Pastel 100% het pied (Keira)
0.1 Butter 50% het Ghost Ball Python (Penny)
0.1 100% het Ghost
0.1 Normal Ball Python (Irwin)
0.1 Mojave Ball Python (Eve)
0.1 Black Bee Ball Python (Charolette)
0.1 Pintripe (Olivia)
0.1 Dumeril's Boa (Peaches)
1.0 Bearded Dragon (Dude)
-
-
BPnet Veteran
Re: Wich morphs can make a BEL?
I think butter/lesser X mojave makes a very white snake.
I can do that! I have a female Mojave that will be ready in 2014 (I hope). I'm afraid if I used a Butter I wouldn't be able to tell the difference between the Butters and the Lessers in future breedings. I'm not that experienced - yet.
Andy -
-
-
Re: Wich morphs can make a BEL?
 Originally Posted by Andys-Python
I can do that! I have a female Mojave that will be ready in 2014 (I hope). I'm afraid if I used a Butter I wouldn't be able to tell the difference between the Butters and the Lessers in future breedings. I'm not that experienced - yet.
Andy - 
I have a female mojave and a female butter on the way, so im either going to get a male with mojave or mystic in it to make either potions or some rockin BELs. 
I want to make a BEL so badly!! Lol
1.0 firefly ball python
1.0 100% Pastel het clown ball python
1.0 Enchi ball python
1.0 Super Pastel 100% het pied (Richard)
0.1 Butter 100% het ghost
0.1 Pastel 100% het pied (Keira)
0.1 Butter 50% het Ghost Ball Python (Penny)
0.1 100% het Ghost
0.1 Normal Ball Python (Irwin)
0.1 Mojave Ball Python (Eve)
0.1 Black Bee Ball Python (Charolette)
0.1 Pintripe (Olivia)
0.1 Dumeril's Boa (Peaches)
1.0 Bearded Dragon (Dude)
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|