» Site Navigation
0 members and 1,829 guests
No Members online
Most users ever online was 54,199, 06-29-2026 at 02:43 AM.
» Today's Birthdays
» Stats
Members: 76,104
Threads: 249,252
Posts: 2,572,980
Top Poster: JLC (31,651)
|
-
05-22-2013, 05:04 PM
#121
-
The Following 2 Users Say Thank You to Mike41793 For This Useful Post:
satomi325 (05-22-2013),Theodore Tibbitts (05-22-2013)
-
05-22-2013, 06:57 PM
#122
Re: What are Pieds? (Jinx)
 Originally Posted by TessadasExotics
That is where the problem is. All recessive ball pythons have het "markers" all of them. Everyone who breeds recessives can pretty confidently pick out their het hatchlings... so either these recessives are either recessive or they are not. It's not restricted to just pieds.
Wait... did you just argue against the point you've been arguing...?
Balls:
*0.1 Mojave *0.1 Pinstripe *0.1 Bumblebee *1.0 Super pastel butter *1.0 Mojave orange ghost *0.3 100% het orange ghosts *0.1 Pastel 50% het orange ghost *1.1 PE Lemonback fires *1.0 Fire *0.1 Pastel *1.0 Albino *0.1 Spider 100% het albino
Other critters:
*1.0 Anery motley corn *G. rosea tarantula *G. pulchripes *P. metallica *0.0.2 A. versicolor *C. cyaneopubescens *A. geniculata *B. smithi *B. boehmei *Nhandu chromatus *H. maculata *C. marshalli *1.0 Australian shepherd mix
-
-
05-22-2013, 11:25 PM
#123
Tessadas - One thing that I've noticed you saying repeatedly is that het snakes don't look like there homozygous counterparts within a givin gene. This is true, but it still doesn't make them recessive. Cinnamons don't look like super cinnies, lemonbacks don't look like BlkELs, mojos don't look like BELs, etc. Does this make them recessive? Absolutely not! You have said yourself that you believe a mutation to be recessive if a heterozygote doesn't differ from the WT homozygote in terms of morphology. You also said that you can pick out your het lavender albinos from non-hets BASED ON APPEARANCE (not yelling, just emphasizing - I don't yell on the internet.) while, at the same time, saying that the mutation is simple recessive. Do you really not see how that is you contradicting yourself?
I have loved this thread! Gaining knowledge through questioning accepted norms that haven't actually been proven always get me excited. I've gotten some feelings reading this thread that have reminded me of when I rejected belief in a god and opened my eyes to what I believe is reality. Just like then, there are those here now that still insist on charging ahead blindy with what they already know and I will never understand why. What is so bad about finding out that you were wrong about something, especially in a case like this where you are far from alone in your beliefs? Is it not better to learn that you were wrong and in the process learn the truth than to go on being wrong for the rest of your life? I really am dumbfounded by some of the close minded things that have been said thus far here.
Last edited by gsarchie; 05-22-2013 at 11:26 PM.
Bruce
Top Shelf Herps
1.0 Pastel (Gypsos)
1.0 VPI Axanthic Pinstripe (B-Dub)
1.0 Sable het Hypo (Flat Top)
1.0 Lesser Platinum (Sean2)
1.1 Lemonback (Einstein.Elsa)
0.1 Pied (unnamed)
0.1 Pinstripe het Hypo (Chopper)
0.1 het VPI Axanthic (Vanilla)
0.1 Spider 50% het VPI Axanthic (Serine)
0.1 Hypo (Bella)
0.1 het Hypo (Hooker)
0.1 Cinnamon (Nutmeg)
0.1 Normal (Jane)
-
The Following 5 Users Say Thank You to gsarchie For This Useful Post:
Coleslaw007 (05-23-2013),Royal Hijinx (05-22-2013),satomi325 (05-23-2013),Theodore Tibbitts (05-23-2013),whispersinmyhead (05-22-2013)
-
05-23-2013, 02:47 AM
#124
What are Pieds? (Jinx)
What is pied?
Baby don't hurt me,
Don't hurt me,
No more.
---------
0.1 Dog (Truffles)
0.1 Naked Cat (Mercedes)
1.0 Hamster (Pumpkin)
1.1 Bumblebees (Satyana & Weedle)
0.3 Normals (Shayla, Rita and Althea)
0.1 100% Het Pied Ringer (Avalon)
1.0 Pied (Monsieur Piederoff)
1.0 Lesser 100% Het Albino poss het OG (Tinersons)
0.1 Spider Albino (Ivy)
0.1 Mojave Cinnamon (Morticia)
1.1 Normal BCIs (Damon and Conga)
0.1 Crested Gecko (Natasha)
0.0.1 Rosehair Tarantula (Charlotte)
0.0.1 P.Metallica
0.0.1 A.Avicularia
0.0.2 P.Irminia
0.0.1 L.Parahybona
0.0.1 N.Coloratovillosus
?.?.? ASFs 
-
The Following 4 Users Say Thank You to I-KandyReptiles For This Useful Post:
bfirecat (05-29-2013),Coleslaw007 (05-23-2013),sharkrocket (05-26-2013),STjepkes (06-15-2013)
-
05-23-2013, 03:31 AM
#125
BPnet Veteran
So recessives are co dom, and het reds are recessive and every dinker has its day i guess.....
-
-
05-23-2013, 08:35 AM
#126
 Originally Posted by Royal Hijinx
Ok, I am washing my hands of this thread, as I have little patience for the unreasonable.
Maybe Brant or Travis will have more to say, maybe not.
Nope, after this post I am done. I have tried, lord knows I have tried. And I think the people who were actually interested in learning something have gotten all they need to know out of this. So I am not going to stay around and be falsely accused of being a horrific source of misinformation and told that I making the hobby worse by someone who is being purposefully obtuse and wantonly obfuscating. That and I am tired of the cries of foul over things that are not even imaginably insulting coming from the mouth of someone who is blatantly being petty, spiteful, vindictive, malicious, snarky and petulant.
 Originally Posted by TessadasExotics
I do understand genetics and my knowledge is not that limited. Despite what you may feel.
Now by your example/interpritation of why a pied is not recessive..... I can pick out our het lavs and our het hypos from our hatchlings. Does this make them non recessive? How about people who can pick out their het albinos? Im sorry but just because a pied allele can slightly influence the het snake WT allele does not rule it out as not a recessive trait. Another example. And understand I am not talking about added mutations I am talking WT. Many WT show the het pied markers yet they are in fact not het pied. That being said if I took 1 or 2 hetppieds and put them with 20 WT snakes, do you honestly think that you can positively identify those 1 or 2 het pieds from out of the group? I think not. Sorry but I dont buy it.[/QUOTE]
As Jinx so susinctly pointed out:
 Originally Posted by Royal Hijinx
The key to a subtle mutation is that while you may not be able to pinpoint EXACTLY what is off (as far as ID of the morph) but you surely be able to see the SOMETHING is different from the normal appearance. IF you can SEE this difference in the heterozygous form, the mutation is NOT recessive. Sometimes polygenetic variability will do a good job of masking the subtlety, but it is still there. This goes back to the idea of 100% ID of het Pieds out of a random pool of say 100 snakes. What I would say is that they may not be immediately ID'd as het Pied, but they are more likely to at least be ID'd as DIFFERENT. I submit that if you put two Specters in a tub with 100 normals, not tell anyone what morph is in there and how many, the success rate of someone saying I found two Specters would be low, with the rate of saying they found two "different" snakes higher. And depending on the variability among the normals some folks would not find any anomalies. So in this case markers may or may not help, but does not really change the fact that (in this case) Specter is a visible inc-dom mutation, and the markers (however subtle) ARE there. The results for het Pied in the same scenario would likely be similar.
Let me extend that analogy to answer your ridiculous contention that because you can pick out every het know under the sun that means that there is no such thing as a recessive anything.
1) If I take 990 WT animals and throw in 10 Lessers, could you pick those out?
2) If I take 990 WT animals and throw in 10 Huffman, could you pick those out?
3) If I take 990 WT animals and throw in 10 Leopard, could you pick those out?
4) If I take 990 WT animals and throw in 10 Specters, could you pick those?
5) If I take 990 WT animals and throw in 10 Paints, could you pick those out?
6) If I take 990 WT animals and throw in 10 het BlackLace, could you pick those out?
7) If I take 990 WT animals and throw in 10 het Lav, could you pick those out and?
8) If I take 990 WT animals and throw in 10 het Albino, could you pick those hem?
9) If I take 990 WT animals and throw in 10 Pied, could you pick those out and?
I already know that your answer to 1-6 would be “Yes” because they are all inc-dom according to convention. And you would say “No” to 7-9 because convention has held that those are all recessive.
Now, let me repeat the scenarios but ask the question thusly: could you pick those out ten animal, and only those ten animals and no others and absolutely identify them? If you said “yes” to anything other than 1) then you are a liar plain and simple.
Oh, I am sure you could pull Huffman-like and Leopard-like and Specter-like and Paint-like animals. But if I limited you to only pulling ten animals then you would undoubtedly fail to pull all ten of what I put in there simply because there are some aberrant WT that have phenotypes similar enough to all of those and yet are not stably heritable and you would inadvertently pull one of those instead of the true morph. And yet all of those are considered inc-dom… How do you justify that? According to you we ought to re-label all of them recessive because there are enough WT that look like them out there that you can never really know if it is the mutation or just all the other genes in the animal at play.
And now I will ask the same question one more time but put it to Jinx’s criteria. I take 990 WT and mix in 10 whatever. And now I will let you pull any animals you want that are “different”. Under those criteria, I would put good odds that someone with a trained eye could get animals that fit the criteria 2-6 and 9 but no one would be able to get 7 or 8, regardless of how good their eye was. Add another layer to it. Now you can breed whatever animals you pull but only to WTs. If you are dealing with animals that really are 2-6 and 9 you will see a heritability pattern when you breed them out but again, with 7 and 8, you certainly will not see heritability.
Now, the second layer of argument against your terminal logic flaw on how you can pick out het whatevers that you are blatantly ignoring; If I give someone, without telling them what they are, a WT and het Pied animal and breed them to a WT, I can look at the clutches and see that in one of the clutches there are animals that are markedly different, those are the het Pieds. And then I can take those and breed them to a WT and pick out the het Pieds. And then I can take those and breed them to a WT and pick out the het Pieds, ad infinitum. If I do the same thing, hand someone a WT and a het Lav/Hypo/Albino/whatever without telling them what the animals are and have them breed to WT then when you look at the clutches, you CANNOT see offspring that are markedly different. And you cannot therefore repeat the process on and on like you can with other inc-doms. This same thing holds true for the occasional WT that has similar “markers,” you can try breeding those out but with them the “marker” will not be consistently heritable in the same way as the het Pied traits are.
No that it will make a lick of difference to you but there are two reasons why your argument fails: 1) You could never potentially pull a het Lav or het Hypo or het Albino just by looking for “atypical” animals and 2) when you start with a het you will not see a heritability patter when breeding to WT. It is possible to do that with an inc-dom type mutation. Granted, if you are pulling from a thousand animals you might pull an animal that looks like it is carrying the Pied gene that does not prove out. But that exact same argument applies to EVERY other inc-dom morph as well.
 Originally Posted by Coopers Constrictors
..... Anyways .....
Travis and Brant have some damn good experience and knowledge in this stuff and I can't wait to see what comes out in the next few years. Having personally met Brant, and purchased a few of his Prospects, the guy has an eye for things... and a damn good eye at that... Travis is just, well, a Freaking genius at this stuff... and a darn good mentor... whether he knows it or not. This exact topic is what brings a lot of people into this 'lifestyle', per say, because of the interesting things that happens to these creatures and mysterious genetics behind it all.
Rock on guys.
Thank you Jerry. I greatly appreciate that 
 Originally Posted by bunnykit
"Until something is proven by more than your own experience overconfidence in your own ability will only do you harm, and close any paths in your mind to be open for new ideas."
This is proven by more than one persons experience and it has nothing to do with overconfidence. There is absolutely no harm in people having discussions. Pigheaded obstinance for no sake other than to be contrary… that is a whole other matter.
 Originally Posted by bunnykit
And 20 years experiance on three guys....that's on avarage what... 6.6 years per head? That's like 6-7 breeding seasons on average per person then. I'm sorry, but that's not all that impressive, I've seen 70 year olds that didn't know anything about anything they are doing - age and time spent on something does NOT guarantee that you have learned all you can learn and it does NOT guarantee that you can see, or do, something better than someone who have been doing the same for lesser amount of time.
If you want to say that what I have done with my life and my education is worthless then go right ahead. To be frank, I could give a rip what you think. I am proud of my accomplishments and I do not need your approval nor do I particularly care what you think of me.
Also, I have already admitted that I do not know everything. And when I do not know something I take the time to try and learn what others have to teach me. The same way that some people have taken the time to try and learn what I have had to teach them. I have yet to see you (or Tessa for that matter) admit that maybe you might be able to learn something new.
 Originally Posted by bunnykit
I have another quote for you then, it suits you and us all in this thread very well in all aspects;
“We learn more by looking for the answer to a question and not finding it than we do from learning the answer itself.” - Lloyd Alexander
I can quote famous people all day long too. It does not make you smart… In fact, it kind of makes you look like you are not capable of original thought, but maybe that is just me…
 Originally Posted by bunnykit
Also another thing that is interesting, and relate to my earlier post in this thread is that there was this famous racing horse, I can't remember his name atm, but he was red with a white blaze. They made clone foals from his dna, trying to see if they could re-create the famous race horse that was their 'original'.
This is not a made up story, google can probably help you find it.
Anyhow, they cloned the horse, they were 100% genetically identical to each other and their dad, however this is what caught MY eye;
The blaze in the foals foreheads were all different. Their genes were exactly the same, but they looked different.
With other words, it would, in theory be nothing genetically different going on in a visible het and one without markings, it's all within the range of possibilities.
That is why I am saying that genetics are way more complex than some people would like to believe. The end result affected by so many factors, I don't think we will ever map them all down.
Why are identical twins not really identical?
I can answer this for you but would you really care? Obviously not because you have already made up your mind that you know all there is to know on the topic and that I would just be getting off on my overvalued education.
Oh, and just for the record, this example is actually moot because the cloning process, as it stands, is by no means tried, true or stable and it certainly is not perfect. As such, none of the clones are “perfect” copies of their father.
 Originally Posted by TessadasExotics
We can guess all we want. I can tell you as theory based on my knowledge that the homo pearl and the spider sable probably suffer from a leathal frame shift mutation. One that causes damage to an esential function of a protein. Spiders probably suffer from a damaged protein that affects the nervous sytem.
Citing one of the most common form of genetic mutations as “the” cause is not that original. I can toss out theories all day long too, education notwithstanding I can just open up a high school textbook.
Actually, the mutation is caused by a premature stop codon.
Or maybe it is siRNA…
Or maybe a TR binding site mutation…
How about a destabilized PE…
Just throwing out terms with nothing to back it up is worthless
 Originally Posted by TessadasExotics
I am not saying that nothing can change. What I am saying is that just because you think your right that it has to be because you have a phd or you know more than everyone else. Why confuse everyone else with your thoughts? Why muddy things up more. Prove out your theory dont just rock the boat.
Well since it seems that you have decided for the entire world that us talking about our theory “muddies the water” I guess we all ought to just shut up. I am glad to know that you are here to protect everyone by telling them that Brant and Jinx and I are just too dumb to have any ideas that ought to be talked about because they go contrary to decades of complacent acceptance. I will remember that in the future; whatever was said is set in stone and do not talk about anything contrary to that because it just muddies the water.
 Originally Posted by paulh
Different textbooks have different definitions for incomplete dominant, codominant, overdominant, semidominant, partial dominant, and other terms for genes that are not fully dominant or fully recessive. As far as a breeder is concerned, all of them can by lumped together as synonyms for simplicity -- if they are an intergrade or otherwise different than the homozygites it is incomplete dominant (= codominant = partial dominant = semidominant = etc.). For what it's worth, the prof I worked for used codominant because it had the fewest characters to write. Semidominant is almost as short.
From the pictures of homozygotes and heterozygotes I have seen, both lesser platinum mutant gene and the mojave mutant gene are codominant to the corresponding normal gene.
Codominance can be hard to prove. IMO, if someone inexperienced can pull out 95% of the heterozygotes from a bin containing all three genotypes, then the gene is codominant. But that requires listing the phenotypes of all three genotypes and keeping breeding records. How subtle are the differrences and how reliable are those phenotypes for identifying genotypes? In other words, beat the nay-sayers to death with data. I haven't seen such data. Till then I lean towards keeping pied classified as a recessive.
Paul,
Most textbooks have fallen into a poor example of co-dominance, that being the red/white flower analogy. This is not co-dominance but incomplete dominance. Co-dominance and incomplete dominance are two separate things and not terms that can be used interchangeably.
I really do not have it in me right now to go in to the nitty gritty details but in a nutshell co-dom is a relationship that can only occur between two independently dominant alleles. Like the A and B blood types: A is dominant, B is dominant. Neither A nor B alone are co-dominant, they are only co-dominant with relation to each other. As such, no morphs in the hobby are known to be co-dominant.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 8 Users Say Thank You to asplundii For This Useful Post:
Coleslaw007 (05-23-2013),HypoLyf (05-24-2013),Royal Hijinx (05-23-2013),satomi325 (05-23-2013),Slowcountry Balls (05-23-2013),snakesRkewl (05-23-2013),Theodore Tibbitts (05-23-2013),whispersinmyhead (05-23-2013)
-
05-23-2013, 09:09 AM
#127
Re: What are Pieds? (Jinx)
Correct me if I am wrong, but the correct definition of recessive and incomplete dominate genes are:
Recessive – Visually different from the wild type when in the homozygous form only. The heterozygous form is visually indistinguishable from the wild type
Incomplete Dominate – Visually different from the wild type when in the heterozygous form and visually different from the wild type and the heterozygous form when in the homozygous form.
So what seems to be in question is “What identification rate?” and by “How experienced of an eye?” defines the difference between a recessive gene and an incomplete dominate gene.
In our hobby, we currently have genes that are extremely subtle and difficult to identify in the heterozygous form that we consider to be incomplete dominate genes. A few that come to mind are Paint, Sentinel, Gravel, Specter, and Spark. These genes can be very difficult for experienced breeders/collectors to properly identify. The fact that wild caught and captive hatch animals showing markers for these genes are sold at a lower price tells us how hard it can be to identify these genes in their heterozygous form. This error/risk does not lead us to classify them as recessive.
As for wild type displaying “markers” of a gene, we could look at Granite for this. Some animals displaying a Granite pattern or “markers” prove to be dominate, incomplete dominate, or not even genetic. The fact that some of the animals displaying this gene’s makers prove to be non-genetic does not change the fact that some of the animals displaying the “markers” are genetic, even dominate or incomplete dominate.
This brings us back to the original question, is the Piebald gene recessive or incomplete dominate. I don’t have enough experience to answer that, but based on what I have been reading (here and other resources) and my own observations of the Hypo gene, I think there is a real possibility that some of our classically labeled recessive genes may actually be very subtle incomplete dominate genes.
I think that this thread has been good. It is always good to question the status quo (in a respectful manner), for that is how we strengthen our understanding or correct errors in our understating. Asking “Why do I believe what I believe?” and “Have any new facts come to light that should change what I believe?” are good and important questions because they cause our beliefs to become stronger or to be corrected.
Looks like Travis basically posted the same thing while I was typing up my thoughts.
Last edited by Slowcountry Balls; 05-23-2013 at 09:14 AM.
-
The Following 4 Users Say Thank You to Slowcountry Balls For This Useful Post:
asplundii (05-23-2013),satomi325 (05-23-2013),snakesRkewl (05-23-2013),whispersinmyhead (05-23-2013)
-
05-23-2013, 10:00 AM
#128
BPnet Veteran
The question here becomes where to draw the line. I like the idea of having recessive being a strict rule where you cannot tell the het from a WT. if you can it is not recessive. Incomplete dominant is a better fit for catching some of the grey area.
Side note: (since theories can be thrown around) I see miney as being a motivating factor for those unwilling to even think about letting go of the current paradigm with regards to recessive morphs. A recessive earns more money because you can sell hets and poss. Hets where the possible hets give you more money than a normal. For those whom are not honest this can be a big money maker. Especially if they can pick out hets and keep them for themselves. I like to think most breeders are honest and on this for the love of the animals. Human nature dictates there will always be a few. I by no means accusing anyone here of such actions but I could definitely this as a speed bump to progress. The other major speed bump is many people's natural resistance to change.
Personally I have already stared to think based in the experienced breeders, that can pick out her pieds, i see there a fairly reliable visual ID, and therefore it should be labelled inc. dominant like other subtle inc. dominant genes (Spector). Now if the argument is made that it is difficult to ID reliably and as such recessive. Then we should be changing a good number of incomplete dominant a as well. I couldn't pick out a Spector if my life depended on it right now. My skill eye is not that trained. That doesn't mean I won't be able to next year. I may also be able to pick out get pieds and such too.
I think at this point in time this thread served its purpose. I have found it a great learning experience and it has challenged me to think hard about BP genes. Like I have said I am still very new to snakes and ball pythons. I really value discussions like this even if I am not interested in the morph. (Probably the only one that doesn't really enjoy pieds). I would love to see some breeders with different sources if pied, do some tracking on breeding these to normals and post the results in a few years. I think it is a worthy project. More hard data is needed IMO to make this strong theory proven.
Thank you so much everyone for this discussion. It has been. A great read.
Jim
2.2 Ball Pythons
Female Pastel (Gella), Female Butter (Khaleesi), Male Spider (Igor), Male Pastel Butter (Tig)
Reptiles
1.0 Bearded Dragon (RIP Freddie)
-
The Following User Says Thank You to whispersinmyhead For This Useful Post:
-
05-23-2013, 10:24 AM
#129
I was not going to comment further but Jim makes a wonderful point I want to address: poss hets
I have heard the following three statements (or some derivatoin therein) from more than a few breeders, big and small. Some of these were said, to my face, while I was vending at shows
1) I love poss het Pieds because when I breed my het Pied to het Pied I can tell which of the offspring are hets and hold them back but still sell the ones I know are normal as 66% and make some extra on them.
2) I hate that I am having to sell this animal as a 66% because I know by looking at it that it is a het Pied. But because it came from a pair of hets I have to label it that way because people do not realize you can pic het Pieds and when you try to explain it to them then they think you are just trying to gouge them for more money.
3) I just quite selling poss het Pieds as poss hets. I can pick the het Pieds easy enough and if I make a mistake it is going to be that I miss a het and sell it as a normal and so someone gets a bonus. But I have never pulled an animal that I was sure was a het Pied and been wrong.
If there are breeders, big name breeders, saying these things then maybe, just maybe, we peons ought to be listening.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 2 Users Say Thank You to asplundii For This Useful Post:
snakesRkewl (05-23-2013),whispersinmyhead (05-23-2013)
-
05-23-2013, 11:28 AM
#130
Atgagtataagaaacataacctggataacatggataacgcatacccatgagccacacgattaaatgagcatcggccatac ccttgagtcatcggccaacgacgacgaggcgttctag
Last edited by TessadasExotics; 05-23-2013 at 11:30 AM.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|