Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 746

1 members and 745 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,905
Threads: 249,104
Posts: 2,572,099
Top Poster: JLC (31,651)
Welcome to our newest member, Pattyhud
Page 7 of 16 FirstFirst 12345678910111213141516 LastLast
Results 61 to 70 of 153
  1. #61
    BPnet Veteran TessadasExotics's Avatar
    Join Date
    03-05-2010
    Location
    CT
    Posts
    1,642
    Thanks
    202
    Thanked 466 Times in 397 Posts
    Images: 214
    Oh not to mention genes can become attached to others on a different loci. Do a little more research.
    Lotsa Balls and more

    http://www.tessadasexotics.com/

  2. #62
    BPnet Royalty Mike41793's Avatar
    Join Date
    12-15-2011
    Posts
    16,925
    Thanks
    6,667
    Thanked 7,981 Times in 5,584 Posts

    What are Pieds? (Jinx)

    I've been following this still and regardless of what emotions are driving people to type these words; it seems to be getting a bit heated lol.

    I'm not picking on you Tessadas, but telling a geneticist that they're wrong and they need to do some more research is just a bit rude/insulting imo. I mean its one thing to debate, but thats not debating lol.
    1.0 normal bp

  3. The Following 6 Users Say Thank You to Mike41793 For This Useful Post:

    adamsky27 (05-21-2013),BHReptiles (05-21-2013),Coleslaw007 (05-21-2013),satomi325 (05-21-2013),STjepkes (05-21-2013),whispersinmyhead (05-21-2013)

  4. #63
    BPnet Veteran TessadasExotics's Avatar
    Join Date
    03-05-2010
    Location
    CT
    Posts
    1,642
    Thanks
    202
    Thanked 466 Times in 397 Posts
    Images: 214
    I do stand corrected. And he should do more research. I could care less how much of a genetics expert he thinks to be. He was the one that wants to attack. Thats besides the fact though as i am confident and comfortable with the ammount of genetics that i know. Fortunately its more than wiki lol. Hmm im pretty sure he was the one who started being rude/insulting, not I. I guess we are both at fault. As far as debating, he's not debating either. Just trying to belittle and over power with his "knowledge". Its all good he can keep his non recessive recessives.
    Pied is in fact an autosomal dominant in humans.
    Last edited by TessadasExotics; 05-21-2013 at 10:58 AM.
    Lotsa Balls and more

    http://www.tessadasexotics.com/

  5. #64
    BPnet Senior Member Royal Hijinx's Avatar
    Join Date
    12-01-2011
    Location
    San Diego, CA
    Posts
    3,842
    Thanks
    1,120
    Thanked 1,989 Times in 1,155 Posts

    Re: What are Pieds? (Jinx)

    Quote Originally Posted by TessadasExotics View Post
    I do stand corrected. And he should do more research. I could care less how much of a genetics expert he thinks to be. He was the one that wants to attack. Thats besides the fact though as i am confident and comfortable with the ammount of genetics that i know. Fortunately its more than wiki lol. Hmm im pretty sure he was the one who started being rude/insulting, not I. I guess we are both at fault. As far as debating, he's not debating either. Just trying to belittle and over power with his "knowledge". Its all good he can keep his non recessive recessives.
    Pied is in fact an autosomal dominant in humans.
    I believe he in fact has a PhD in genetics... so you may want to re-assess your "comfort" with your "knowledge".

  6. The Following User Says Thank You to Royal Hijinx For This Useful Post:

    Coleslaw007 (05-21-2013)

  7. #65
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: What are Pieds? (Jinx)

    Quote Originally Posted by TessadasExotics View Post
    Look im done with your silly argument.
    My (and Brant's and Jinx's and Kewl's) arguments are not silly. They are actually well thought out and explained and backed up with significant experience.


    Quote Originally Posted by TessadasExotics View Post
    You fail to grasp a simple concept of simpOre recessive.
    I grasp simple recessive just fine thank you.


    Quote Originally Posted by TessadasExotics View Post
    Pied is known for being recessive in all other animals as well as leucism. Just because you say its so, despite all other data is not the defining correct answer.
    Pied is not known for being recessive. Pied was assigned the label "recessive" by someone early in the dark ages of herping who, like you, had an incomplete grasp of genetics. This is the same reason all of our inc-dom mutations are universally, wrongly, called co-dom. Someone who thought they knew more than they actually did started talking about something as if it were fact when it was not.


    Quote Originally Posted by TessadasExotics View Post
    Genes can have an influence on other genes.
    Quote Originally Posted by TessadasExotics View Post
    The genes we are working with in ball pythons are on more than just one locus. One locus can affect another. Just because you may be able to pick out a pastel het clown still does not make it not a recessive trait.
    I never said they could not. But you are looking at it too narrowly. Regardless of any other mutations, there is a distinct yet subtle phenotype to the hets in Pied. In the presence of some mutations that subtle phenotype becomes less subtle, but it is always there. That makes them inc-dom.


    Quote Originally Posted by TessadasExotics View Post
    Breedings of these mutarions prove without a doubt that they are simple recessive yet you continue to say otherwise.
    No! I do not just "say otherwise". I (and other) look at data and trendlines observed by breedings of these mutations, by people with significantly greater experience and knowledge than you, which indicates that the decades-old label of recessive was premature and mistaken and that it is more appropriate to call them inc-dom.

    As Nick Mutton is fond of pointing out: Specters and Paints are more subtle than het Pieds, why do we call them inc-dom?


    Quote Originally Posted by TessadasExotics View Post
    Go ahead and keep missinforning others.
    Careful who you make that accusation of.


    Quote Originally Posted by TessadasExotics View Post
    This hobby is already missinformed as it is.
    And as I have said numerous times I am not the one spouting off misinformation.


    Quote Originally Posted by TessadasExotics View Post
    Its going to be funny when some people will start saying the breed codom clowns. Or seeing the look on breeders faces when someone tells them that their pied is codom.
    I have said numerous times that I am still on the fence with Clown but there are plenty of breeders, big name ones at that, who already agree that Pied is inc-dom


    Quote Originally Posted by TessadasExotics View Post
    The other thing I find funny. With my so called lack of knowledge on genetics. You have always agreed with what I have had to say before and now all of a sudden I dont have a clue about what im talking about.
    I have never "always" agreed with you. And I can grant that I may have agreed with you on occasion in the past but that does not mean I will always agree with everything you say.

    Also, I could make the same argument. Why now all of the sudden do you accuse me of not having a clue what I am talking about when you have agreed with me in the past??


    Quote Originally Posted by TessadasExotics View Post
    Oh not to mention genes can become attached to others on a different loci. Do a little more research.
    I do not need to do a little more research. Two genes cannot "fuse in to one" as Kevin claims happened with the HGW and Granite


    Quote Originally Posted by TessadasExotics View Post
    He was the one that wants to attack… Hmm im pretty sure he was the one who started being rude/insulting, not I.
    I was not attacking, rude or insulting. At least not by intent and I do apologize if it seemed that way.

    I will say however that you accusing me of wantonly spreading misinformation was more than a little offputting.


    Quote Originally Posted by TessadasExotics View Post
    As far as debating, he's not debating either. Just trying to belittle and over power with his "knowledge". Its all good he can
    I accept the accusation that I am not debating because, frankly, I am not. But I am not belittling and overpowering as a means of getting my kicks in. As I have had to say to many many people before in situations like this: I never claimed to know more than everyone about everything. I know more than some people and I know less than other people. When I know less than someone, my goal is to learn. When I know more than someone I strive to teach. It is just really hard to try and teach someone when they are so set on refusing to listen to anything or consider that just maybe they could learn something.


    Quote Originally Posted by TessadasExotics View Post
    I could care less how much of a genetics expert he thinks to be..
    Quote Originally Posted by Royal Hijinx View Post
    I believe he in fact has a PhD in genetics... so you may want to re-assess your "comfort" with your "knowledge".
    There is a reason my signature reads the way it does. Cheers Jinx
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  8. The Following 12 Users Say Thank You to asplundii For This Useful Post:

    + Show/Hide list of the thanked

    BHReptiles (05-21-2013),Coleslaw007 (05-21-2013),Dave Green (05-21-2013),eatgoodfood (05-21-2013),HypoLyf (05-21-2013),Inarikins (05-21-2013),interloc (05-21-2013),Royal Hijinx (05-21-2013),satomi325 (05-21-2013),snakesRkewl (05-21-2013),STjepkes (05-21-2013),whispersinmyhead (05-21-2013)

  9. #66
    BPnet Veteran
    Join Date
    04-09-2012
    Location
    Germany
    Posts
    685
    Thanks
    244
    Thanked 208 Times in 147 Posts
    I think this discussion or whatever you want to call it is pretty simple, there is one person who thinks they know everything and just states its so, and says it cant be questioned, while there is another who very carefully chooses his words, backs his statements up with examples and knowledge. I for one am on the side of pied being incomplete dominant. It fits, it makes the most sense, and if you want people to think that its recessive just saying so and just because someone said it is does not make it so. Where is a well thought out well backed up reasoning for it being recessive. I see the other side, makes sense, wheres yours? And just because the homozygous phenotype does not look like the heterozygous phenotype does not make it recessive. Just because you cannot differentiate it from a wild type does not mean its not phenotypically different from a wild type.

    What im getting at is where is the proof for the recessive argument?
    Last edited by eatgoodfood; 05-21-2013 at 01:05 PM.

    0.1 Albino
    0.2 Classic
    0.1 Het. Red Axanthic
    0.1 Mojave h. Ghost
    0.1 Pastel
    0.1 Spider h. Ghost
    1.0 Black Pastel
    1.0 Blue Eye Leucistic h. Ghost
    1.0 Lesser
    1.0 Pastel h. Ghost

    0.1 Morelia bredli
    0.0.1 Varanus acanthurus (Silly)
    0.1 Brachypelma auratum
    0.1 Scottisch Fold (Tipsy)
    0.1 Abyssinian (Prim)

    http://www.facebook.com/AAExoten

  10. #67
    Registered User
    Join Date
    06-07-2012
    Posts
    47
    Thanks
    18
    Thanked 22 Times in 13 Posts
    I really like that thread, despite the negative temper that has come up. Maybe that just appertains to such a discussion. However, coming from the 01 industry (IT), I'm not that happy with the actual naming. Since it leads to misunderstanding. I know, one might say that doesn't matter if I'm happy or not, definitely true, but I think there is the crux of the matter.

    Dominant -> Rules over something
    Recessive -> Stands back for something

    Considering this two words, I can't see how the gene(s) responsible for piebald can be incomplete dominant. I actually see the point and agree that genes showing up in heterozygous form can't be simple recessive, at least not in a manner as we used to use the term. So, to not make the chaos bigger as it already is, we probably should let simple recessive be what it is. Simple.

    So, what would fit then? Making a virtual example. Considering every het. pied would show a small ringer (again, virtually), then the term incomplete dominance would fit perfect for my understanding. It shows up in the phenotype but doesn't affect the appearance as the homozygous form does. So incomplete then.

    But that isn't the case on all those genes that we're talking about here. As long as a few are able to pick those heterozygous animals, meaning, as long as there is something in the phenotype to distinguish those from wildtype animals, there is a need for another word in my opinion. They're too subtle to be any sort of dominant. I rather would see the term incomplete/partial recessive, since it is closer to be recessive than dominant. But better something new. Maybe it is time for something new?

  11. #68
    BPnet Veteran interloc's Avatar
    Join Date
    09-25-2011
    Location
    ontario canada
    Posts
    1,538
    Thanks
    331
    Thanked 627 Times in 410 Posts
    Images: 79

    What are Pieds? (Jinx)

    Quote Originally Posted by eatgoodfood View Post
    What im getting at is where is the proof for the recessive argument?
    Because someone called it recessive a long time ago. And the older the theory, the more right it is. Obviously.

    The earth is flat, the sun revolves around the earth, and nobody will ever need a computer in their house.

    Science is all about disproving old theories. Probably at the start of the whole ball python breeding thing, we didn't notice the difference between het pieds and normals. As time went on and our experiments became more frequent, we noticed multiple factors that can aid us in picking out the hets. It's how the world ever moves forwards. We go out and get new info and change our theories. Come on, are we all still rocking model T fords? No! We have improved the car to what we have today.

    Things change. You just got to roll with it.
    Last edited by interloc; 05-21-2013 at 01:14 PM.

  12. The Following 5 Users Say Thank You to interloc For This Useful Post:

    BHReptiles (05-21-2013),Coleslaw007 (05-21-2013),HypoLyf (05-21-2013),Mike41793 (05-21-2013),snakesRkewl (05-21-2013)

  13. #69
    BPnet Royalty Mike41793's Avatar
    Join Date
    12-15-2011
    Posts
    16,925
    Thanks
    6,667
    Thanked 7,981 Times in 5,584 Posts

    What are Pieds? (Jinx)

    Tim brought this to my attention, i didnt think to post it lol. But here is my female cinnamon:


    And here is my other cinnamon. Shes 50% ph pied. Would anyone like to bet against me that she doesn't prove out?

    1.0 normal bp

  14. The Following 3 Users Say Thank You to Mike41793 For This Useful Post:

    4theSNAKElady (05-22-2013),HypoLyf (05-21-2013),satomi325 (08-06-2013)

  15. #70
    BPnet Veteran majorleaguereptiles's Avatar
    Join Date
    11-18-2010
    Location
    San Diego, CA
    Posts
    391
    Thanks
    38
    Thanked 288 Times in 127 Posts

    What are Pieds? (Jinx)

    This narrow-mindedness is something I'm always trying to get people away from. I hope this thread can be enlightening to those who read it.

    I get negativity with imports as well. Only the people who understand what I know and what I do are the ones who really appreciate it.

    I'm always trying to learn, whether from my own experience or for someone who actually has an education in genetics like Travis (asplundii).

    I firmly believe that my ability to make my OWN decisions through my OWN hard work, to acquire my OWN knowledge through my OWN experience has helped get me where I am today. I'm constantly proving out new genes at a rapid pace because I have allowed myself to appreciate the genetics of every ball python. Whether drastic or simple. The fruits of my labor will be seen sooner than later.

    I've learned that all ball pythons are genetic. I've learned that many ball pythons don't take on the appearance of their genetics. I've learned how to recognize the difference. I've learned that even normals have their own genetic traits that can significantly influence other mutations.

    Being able to have an open mind has allowed me to expanded my collection into something I believe is truly special. I actually am very proud of those who have come on here and recognized that these hets can be visual. It actually makes me believe in this industry even more. I hope people continue to dig deeper into ball python genetics as we all continue to expand our knowledge.

    I believe those who are close minded, complacent, dishonest or lazy will be the ones who fail in making this a successful business or hobby for them.

  16. The Following 5 Users Say Thank You to majorleaguereptiles For This Useful Post:

    asplundii (05-21-2013),gsarchie (05-22-2013),STjepkes (05-21-2013),TerrieL (05-25-2013),whispersinmyhead (05-21-2013)

Page 7 of 16 FirstFirst 12345678910111213141516 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1