Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 2,688

0 members and 2,688 guests
No Members online
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

Aag2019 (31)

» Stats

Members: 75,202
Threads: 248,610
Posts: 2,569,192
Top Poster: JLC (31,651)
Welcome to our newest member, CUGrad99
Page 5 of 12 FirstFirst 123456789101112 LastLast
Results 41 to 50 of 111
  1. #41
    BPnet Veteran ChaosAffect's Avatar
    Join Date
    03-29-2013
    Location
    ATL Area
    Posts
    331
    Thanks
    117
    Thanked 60 Times in 53 Posts

    Re: Think I'm in the process of getting ripped off...

    Quote Originally Posted by MrLang View Post
    Says he's in the process of opening a business...


    gets scared at the idea that laws have been broken...


    mom calls.


    You got duped by a teenager bro
    Actually, I've talked to people that've done face to face business with the guy and apparently he's in his mid to late 20's.




  2. #42
    BPnet Royalty Mike41793's Avatar
    Join Date
    12-15-2011
    Location
    Philadelphia, PA
    Posts
    16,924
    Thanks
    6,661
    Thanked 7,979 Times in 5,583 Posts

    Think I'm in the process of getting ripped off...

    My 5y/o is a better businesswoman. She sells the girl scout cookies and delivers!

    This guy is a joke.
    1.0 normal bp
    mad roaches yo

  3. The Following User Says Thank You to Mike41793 For This Useful Post:

    ChaosAffect (05-17-2013)

  4. #43
    BPnet Lifer MrLang's Avatar
    Join Date
    12-13-2011
    Location
    Massachusetts
    Posts
    2,530
    Thanks
    726
    Thanked 1,456 Times in 831 Posts
    Images: 8

    Re: Think I'm in the process of getting ripped off...

    Quote Originally Posted by ChaosAffect View Post
    Actually, I've talked to people that've done face to face business with the guy and apparently he's in his mid to late 20's.
    Sorry my joke was in bad taste. I really hope this gets resolved for you. I would definitely post on the BOI that his mom called you. Even if this gets resolved, I'm pretty sure nobody wants to do business with someone that has their mommy call to defend them after they're clearly in the wrong.

    : /
    Dreamtime Exotics -- Check it out!
    Ball Pythons, Monitors, Saltwater Reef, Fancy Rats, Ferrets

  5. #44
    BPnet Veteran ChaosAffect's Avatar
    Join Date
    03-29-2013
    Location
    ATL Area
    Posts
    331
    Thanks
    117
    Thanked 60 Times in 53 Posts

    Re: Think I'm in the process of getting ripped off...

    Quote Originally Posted by MrLang View Post
    Sorry my joke was in bad taste. I really hope this gets resolved for you. I would definitely post on the BOI that his mom called you. Even if this gets resolved, I'm pretty sure nobody wants to do business with someone that has their mommy call to defend them after they're clearly in the wrong.

    : /
    No worries, man. If I saw that someone's mom started talking for them (She sent me an email, BTW. No call.) then I would assume they were a kid too. For a grown man, though... Of course, from the research I've done it's not really surprising. I was trying to verify the address he gave me and came across a court filing where his mom got custody of his kid.




  6. #45
    BPnet Veteran ChaosAffect's Avatar
    Join Date
    03-29-2013
    Location
    ATL Area
    Posts
    331
    Thanks
    117
    Thanked 60 Times in 53 Posts
    Well, we've got another development. Just got a call from him. He claimed that he lost his phone for a week and doesn't have internet access other than his phone, but he's going to print the shipping label through SYR in the next couple of minutes and send me the tracking. On top of that he said that he'll be shipping me a clutchmate of the original Fire het Albino, another female Fire het Albino, plus a bunch of extra goodies. I'm really in an "I'll believe it when I see it" place, but if he does follow up then it'll go a long way to making up for the past week of uncertainty.




  7. #46
    BPnet Veteran
    Join Date
    04-09-2012
    Location
    Bay Area, CA
    Posts
    212
    Thanks
    6
    Thanked 62 Times in 55 Posts
    Images: 5
    Good to hear that he is at least communicating with you.

    And I agree with the "I'll believe it when I see it mentality".

    Good luck
    0.1 Butter
    0.2 Pastel
    0.1 Cinnamon
    0.1 Bumblebee
    0.1 Cinnamon Mystic
    0.4 Black Pewter
    0.1 Lemonblast
    0.1 Black Pastel Pinstripe
    1.0 Super Pastel
    1.0 Coral Glow
    1.0 Coral Glow Mojave


    Coming soon:
    1.0 Super Emperor

  8. #47
    BPnet Lifer snakesRkewl's Avatar
    Join Date
    09-14-2009
    Location
    Milwaukie, Oregon
    Posts
    7,665
    Thanks
    2,687
    Thanked 3,036 Times in 2,147 Posts
    Images: 2
    On top of that he said that he'll be shipping me a clutchmate of the original Fire het Albino, another female Fire het Albino, plus a bunch of extra goodies.
    yeah, when pigs fly
    Jerry Robertson

  9. #48
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Think I'm in the process of getting ripped off...

    Quote Originally Posted by ChaosAffect View Post
    He claimed that he lost his phone for a week and doesn't have internet access other than his phone, but he's going to print the shipping label through SYR in the next couple of minutes and send me the tracking.
    Two things about this make me cringe

    1) If he only has internet access on his phone then how is he going to print a FedEx label? Or can phones print these days??

    2) I am not sure FedEx does Friday overnight with guaranteed delivery on Saturday and I know that no self-respecting herp shipper would ship on a Friday
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  10. #49
    BPnet Veteran ChaosAffect's Avatar
    Join Date
    03-29-2013
    Location
    ATL Area
    Posts
    331
    Thanks
    117
    Thanked 60 Times in 53 Posts

    Re: Think I'm in the process of getting ripped off...

    Quote Originally Posted by asplundii View Post
    Two things about this make me cringe

    1) If he only has internet access on his phone then how is he going to print a FedEx label? Or can phones print these days??

    2) I am not sure FedEx does Friday overnight with guaranteed delivery on Saturday and I know that no self-respecting herp shipper would ship on a Friday
    1) He's at his mom's house.

    2) It's not going out until Monday.

    I have gotten a tracking number now, though. Things are looking up.

    Oh, and phones can print. I've got a cheapo HP deskjet that has software that actually lets me print to it from pretty much anywhere on my phone. It's awesome.
    Last edited by ChaosAffect; 05-17-2013 at 12:30 PM.




  11. #50
    BPnet Senior Member Archimedes's Avatar
    Join Date
    12-29-2012
    Location
    York, PA
    Posts
    2,073
    Thanks
    922
    Thanked 859 Times in 614 Posts
    Images: 1
    Glad to hear that things are improving. Things happen to the best of us, but all's well that ends well. Keep us updated on what you end up getting.
    1.1 Ball Pythons
    a) Calliope 0.1, Banana Ball, 2018/19 season, 600g
    b) Geralt 1.0 Chocolate Sable Mojave pos. Trick ball, May 27th 2020

    3.2 Cats (Fury, Leviathan, Walter, Chell, Amelie); 2.0 Dogs (Bjorn, Anubis); 2.1 Ferrets (Bran, Tormund, Arya); 0.1 Beardie (Nefertiti); 0.1 Slider Turtle (Species uncertain) (Papaya); 2.0 Hermit Crabs (Tamatoa, Sushi); 0.1 Conure (Mauii); Two Axolotyls (Quetzl and Unnamed); Two Tree Frogs (Pluto and Colossus); One Anole (Zeus); One Crestie (Noferatu); 3.0 Guinea Pigs (Paco, Poncho and Piccolo); 0.1 Pink Toe T (Azula)

    Fish:
    1.1 Oscar Cichlids (Rocky 1.0, hx2020, Red Fire, and Bubble 0.1, hx2019, Tiger), 1.1 Convict Cichlids (Hurley and Sloane), 0.1 Strawberry Peacock Cichlid (Comet), Two Plecos, Rubby the Rubbernose Pleco and Trinidad the common Pleco, 2.0 Upside Down Catfish (Poseidon, Neptune), One Red Parrot Cichlid (Firefly), 1.0 Betta Fish (Jenkins),
    2.2 Cherry Barbs ("The Worst"), 1.0 Electric Blue Acara (Goldeneye)

  12. The Following User Says Thank You to Archimedes For This Useful Post:

    ChaosAffect (05-17-2013)

Page 5 of 12 FirstFirst 123456789101112 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1