» Site Navigation
1 members and 603 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,912
Threads: 249,115
Posts: 2,572,187
Top Poster: JLC (31,651)
Welcome to our newest member, coda
|
-
Hmm, well that sure is interesting. Mom doesn't look fire-ish.
God Bless http://www.iherp.com/elbee
_____
1.0 Pastel, 1.0 Albino, 1.0 Piebald, 1.0 Pastel Butter Spotnose
0.1 Het pied, 0.1 Pewter, 0.1 Super Pastel, 0.1 Champagne, 0.1 BEL, 0.1 Pastel Leopard
1.1 Thayeri Kingsnake
1.0 Hog Island Boa
0.2 Western Hognose (normal and purple line albino)
-
The Following User Says Thank You to elbee For This Useful Post:
-
leucistics are naturally occuring normal to normal just really rare much like albinos. It is the simple explanation.
http://astronomologer.com/wp-content...hite-raven.jpg
-
The Following 2 Users Say Thank You to kitedemon For This Useful Post:
alykoz (11-10-2013),Redemption Reptiles (05-18-2013)
-
it will be much clearer with pics when they are all out, and with pics after 1st shed. Eye color and the specific tone of white could help to solve this puzzle. I wouldnt be surprised if the eyes turn out to be blue. Black eyes would be even more interesting.
maybe its not a fire but something else? could it be something else?
in the blue eye leucistic-complex this happens, i mean is done, all the time. something like lesser x het russo could look quite similar to this. or if its really a fire, maybe this is a different gene that behaves similar to some of the blue eye lucy stuff, just in the gene complex with fire and sulfur.
about the strange "null phenomenon", i need a mechanism how its supposed to happen. for blue eye lucys, meaning the above mentioned example of super phantoms or super mojaves popping up seemingly out of nowhere, ill go with genes like het russo as an explanation. they seemingly do just that.
UV light to check for pattern in the fluorescence is also something to consider later on.
EDIT: In response to kitedemon: Yes, i mean, basically we have genes like that in BPs. Known ones, het russo and a few others. practically recessive stuff that makes lucys. the question will be what exactly it is compatible with.
Last edited by Pythonfriend; 05-17-2013 at 12:37 AM.
-
The Following User Says Thank You to Pythonfriend For This Useful Post:
-
Registered User
Freaking out!! Fire to Normal makes white snake?!!
 Originally Posted by h00blah
Look up "null phenomenon". I'm not quite sure how it works, but I think you will only get one gender of snakes in that clutch. It has happened a few times. Phantom x normal and producing super phantoms. Mojo x bumblebee producing super mojos. Kinda weird. I haven't heard of what happens when you breed the null phenom, but it's still cool
Here ya go: http://www.reptileradio.net/ball-pyt...henomenon.html
Also a possibility
Http://www.BCBallPythons.com
Http://www.facebook.com/bcballpythons
-
The Following User Says Thank You to BCBallPythons For This Useful Post:
-
Registered User
What in the wworld of ball pythons lol. Can't wait to see the out of the eggs this is interesting.
-
-
Registered User
Re: Freaking out!! Fire to Normal makes white snake?!!
The mom had kicked this egg out. It is from an 11 egg clutch. Seems to be if it were genetic there would be more than one in that many eggs!
Sam and Jennifer
RedemptionReptiles.com
1.0 Blue Eyed Lucy
1.8 Normal
1.2 Pastel
1.2 Spider
0.1 Pinstripe
1.1 Enchi
1.1 Yellowbelly
1.0 Fire
1.0 Super Pastel
0.1 Mojave
0.1 Black Pastel
-
-
Freaking out!! Fire to Normal makes white snake?!!
Looking at the pic on my phone so it's small, but to me that simply looks like a clear belly and the bottom of a snakes head?
As though the snake is upside down
Last edited by SquamishSerpents; 05-17-2013 at 06:52 AM.
-
The Following User Says Thank You to SquamishSerpents For This Useful Post:
-
Re: Freaking out!! Fire to Normal makes white snake?!!
 Originally Posted by h00blah
Look up "null phenomenon". I'm not quite sure how it works, but I think you will only get one gender of snakes in that clutch.
Just as a small clarification, "null" phenomenon does not bias the clutch to one gender or another. It is acts of parthenogenesis that are typically recognized by one gender morph clutches.
 Originally Posted by Kurtilein
about the strange "null phenomenon", i need a mechanism how its supposed to happen.
In the link Hooblah posted there is a post by me that has a second link which explains the "null" phenomenon. The "mechanism" is really very simple; a second copy of the gene (in this case the WT copy) is simply missing, by way of any of a number of means.
 Originally Posted by Kurtilein
for blue eye lucys, meaning the above mentioned example of super phantoms or super mojaves popping up seemingly out of nowhere, ill go with genes like het russo as an explanation. they seemingly do just that.
Except that Russos are quite distinct and not likely to be mistaken for WT animals. And Russo x Phantom looks nothing like a SuperPhantom.
That and the same phenomenon has also been seen with SuperCinny/SuperBlack and it is not like there are cryptic alleles of those out there...
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 3 Users Say Thank You to asplundii For This Useful Post:
h00blah (05-19-2013),nykea (07-16-2013),Redemption Reptiles (05-18-2013)
-
Re: Freaking out!! Fire to Normal makes white snake?!!
 Originally Posted by SquamishSerpents
Looking at the pic on my phone so it's small, but to me that simply looks like a clear belly and the bottom of a snakes head?
As though the snake is upside down
Thats what I thought too. Looks like the baby is upside down on my phone.
-
The Following User Says Thank You to BHReptiles For This Useful Post:
-
Registered User
Re: Freaking out!! Fire to Normal makes white snake?!!
 Originally Posted by BHReptiles
Thats what I thought too. Looks like the baby is upside down on my phone.
It is in that pic. Here's a different one.
Sam and Jennifer
RedemptionReptiles.com
1.0 Blue Eyed Lucy
1.8 Normal
1.2 Pastel
1.2 Spider
0.1 Pinstripe
1.1 Enchi
1.1 Yellowbelly
1.0 Fire
1.0 Super Pastel
0.1 Mojave
0.1 Black Pastel
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|