Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 771

0 members and 771 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,912
Threads: 249,115
Posts: 2,572,187
Top Poster: JLC (31,651)
Welcome to our newest member, coda
Results 1 to 8 of 8

Threaded View

  1. #8
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    Let me clarify what I posted earlier.

    People who use it with chickens use it in the chicken bedding and as an additive in dust beds that the chickens scratch/roll in. If it was dangerous to inhale it would be dangerous to the chickens since they are aerosolizing it by scratching/rolling, but they suffer no ill effects. Considering that snakes are not going to be aggressively rolling in it I doubt that they would be able to aerosolize it at all so the odds of them inhaling quantities larger than what chickens breath in are slim, plus the added humidity levels of our tubs are going to keep aerosolization down as well.

    I do not see any reason to suspect it would be harmful
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    GoldSheep (04-24-2013)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1