Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,929

1 members and 1,928 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

blueface (56)

» Stats

Members: 76,060
Threads: 249,212
Posts: 2,572,739
Top Poster: JLC (31,651)
Welcome to our newest member, TillyMintz8613
Results 1 to 8 of 8
  1. #1
    Registered User
    Join Date
    09-14-2012
    Posts
    170
    Thanks
    82
    Thanked 46 Times in 28 Posts

    Diatomaceous earth, food grade and reptiles?

    My apartment has bug issues. I know that mammals have less issue with this product, but how about reptiles? Anyone that's a vet that can tell me if it's safe for reptiles too, definitively? Or if I should leave it outside of the cage only? (the bugs like the warmth, the water supply.... and the bedding...)

  2. #2
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    I do not know about reptile but I know it is regularly used with chickens with no ill effects
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  3. #3
    BPnet Royalty ballpythonluvr's Avatar
    Join Date
    11-23-2008
    Location
    Pennsylvania
    Posts
    8,062
    Thanks
    4,207
    Thanked 3,152 Times in 2,887 Posts
    Images: 6

    Re: Diatomaceous earth, food grade and reptiles?

    I had a bug problem when I lived in an apartment and they used diatomaceous earth to control the problem. The problem was in the bedroom where I kept my snakes. Personally, I removed my snakes from the room and had a friend keep them for me until the bugs were eradicated. I did NOT want to take any risks with my snakes. I have no scientific proof that this stuff is dangerous for reptiles but I was not willing to take any risks at all.

  4. #4
    BPnet Veteran satomi325's Avatar
    Join Date
    08-15-2011
    Location
    In a galaxy far,far away.
    Posts
    6,423
    Thanks
    2,429
    Thanked 3,969 Times in 2,446 Posts
    Images: 5

    Re: Diatomaceous earth, food grade and reptiles?

    I've used it on my dog when she had some mites on her rear back. It cleared them up within a week.

    The only thing I would be concerned about is the dust. You don't want yourself or your animals breathing that in. Since a snake is very low to the ground, it may be a little more susceptible to breathing it in if you use it in the cage. So to be safe, keep it out of the snake enclosure. If you're afraid of some sort of infestation in the snake cage, use PAM or other reptile mite spray. It works for other creepy crawlies too.


    Sent from my DROID RAZR using Tapatalk 2

  5. #5
    BPnet Veteran Andys-Python's Avatar
    Join Date
    11-25-2012
    Posts
    266
    Thanks
    58
    Thanked 80 Times in 60 Posts

    Re: Diatomaceous earth, food grade and reptiles?

    Diatomaceous earth is the skeletal remains of diatoms or single celled algae. The skeletons are made of silicon or glass. The way diatomaceous earth works is by cutting open the skeleton or outer covering of an insect and either kills it directly or allows a chemical, that is mixed with the diatomaceous earth, to enter the insect thereby killing it. I would not recommend using this on or near your pets. There are safer methods of caring for your pets (and I’m a true believer in better living through chemicals – when necessary).
    -Andy

  6. #6
    Registered User
    Join Date
    09-14-2012
    Posts
    170
    Thanks
    82
    Thanked 46 Times in 28 Posts
    As I understand it, the food grade stuff doesn't have chemicals and it's safe for mammals at least to ingest--they put it in food as a preservative, etc (Health nuts like it too). I was a bit concerned about using it in the cage since it's breathing, etc. and reptiles tend to be more sensitive than mammals to such issues. But if someone could guarantee it safe 100%, then I'd like to use it below the current bedding... as no one can, I'll have to use it around and under the cages. (Most of my friends are freaked out by snakes... TT)

    Thanks. If anyone can say positive or negative wither way, I'd like to know. Again, food grade stuff only.
    Last edited by GoldSheep; 04-18-2013 at 12:16 PM.

  7. #7
    BPnet Veteran satomi325's Avatar
    Join Date
    08-15-2011
    Location
    In a galaxy far,far away.
    Posts
    6,423
    Thanks
    2,429
    Thanked 3,969 Times in 2,446 Posts
    Images: 5

    Re: Diatomaceous earth, food grade and reptiles?

    Quote Originally Posted by Andys-Python View Post
    Diatomaceous earth is the skeletal remains of diatoms or single celled algae. The skeletons are made of silicon or glass. The way diatomaceous earth works is by cutting open the skeleton or outer covering of an insect and either kills it directly :
    This is the exact reason why I used it on my dogs hind end. This was after failed attempts of actual pet grade mite killer. This worked way more effectively.

    But I do agree that it could be potentially hazardous if inhaled.

    Sent from my DROID RAZR using Tapatalk 2

  8. #8
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    Let me clarify what I posted earlier.

    People who use it with chickens use it in the chicken bedding and as an additive in dust beds that the chickens scratch/roll in. If it was dangerous to inhale it would be dangerous to the chickens since they are aerosolizing it by scratching/rolling, but they suffer no ill effects. Considering that snakes are not going to be aggressively rolling in it I doubt that they would be able to aerosolize it at all so the odds of them inhaling quantities larger than what chickens breath in are slim, plus the added humidity levels of our tubs are going to keep aerosolization down as well.

    I do not see any reason to suspect it would be harmful
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  9. The Following User Says Thank You to asplundii For This Useful Post:

    GoldSheep (04-24-2013)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1