» Site Navigation
0 members and 1,257 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,934
Threads: 249,129
Posts: 2,572,283
Top Poster: JLC (31,651)
|
-
Re: Two Headed Albino Bateater.
 Originally Posted by creepin
don't know if this has been posted on any reptile forums yet or of this is old and this guy is just trying to pull everyones chain.. but this guy i follow on instagram claims to have just hatched this... freak.
He's definitely yanking chains...why lie about something like that??? So pathetic!
http://www.youtube.com/watch?v=YNnukywp__k
-
-
Re: Two Headed Albino Bateater.
 Originally Posted by JLC
thank you. lol that's why i posted it hear. figured if someone had seen these images you guys would call it out.
Last edited by TheSnakeGeek; 04-13-2013 at 02:12 PM.
-
-
Re: Two Headed Albino Bateater.
 Originally Posted by JLC
Another case solved by Judy.
1.0 Pied Ball Python (Rumple Stillkins) 2.0 Normal Ball (Simba) (legolas) 1.0 Pastel Ball (Isildur) 0.1 Normal Het? (Sarabi RIP 2013) 1.0 Burmese Python (Sephiroth) 0.1 Granite Burmese Python 1.0 Albino Burmese Python 1.0 Tiger Retic (Steve Irwin RIP 2012) 0.1 Lavender Albino Tiger (RIP 2012) 1.0 Spider Ball Python Spidey 1.0 Pewter Ball (pew pew) 0.1 Cinnamon Ball (Cinny) 1.0 Lavender Albino Retic (Old Yeller) 0.1 High Contrast Albino Retic (Sunshine) 0.1 BCI (Ruby)
Here I Stand, The Black Sheep Of The Family, To you, Worth Less Then Zero. A Chef And A Reptile Lover. Yet, Reptiles Are Not A Hobby, But A Way Of Life.
-
-
Re: Two Headed Albino Bateater.
 Originally Posted by JLC
Every time I see this guy pop up, he's being a complete idiot.
If nothing ever changed, there would be no butterflies.
-
-
Two Headed Albino Bateater.
I didn't even bother to read his lesson since he believes I misused loci lol... His point is moot since the species are not genetically similar enough to be compatible in albino crosses. And yes after looking again those screen shots are from Jays two headed white albino Retic...
Sent from my iPhone using Tapatalk
-------------------------------------------------------
Retics are my passion. Just ask.
www.wildimaging.net www.facebook.com/wildimaging
"...That which we do not understand, we fear. That which we fear, we destroy. Thus eliminating the fear" ~Explains every killed snake"
-
-
Re: Two Headed Albino Bateater.
 Originally Posted by zeion97
Another case solved by Judy. 
Nope...NormanSnake brought it up. I just posted the link he was referring to.
-
-
Re: Two Headed Albino Bateater.
 Originally Posted by reptileexperts
I didn't even bother to read his lesson since he believes I misused loci lol... His point is moot since the species are not genetically similar enough to be compatible in albino crosses. And yes after looking again those screen shots are from Jays two headed white albino Retic...
Sent from my iPhone using Tapatalk
How long have you been working with retics and how many of what type do you personally own?
I may not be very smart, but what if I am?
Stinky says, "Women should be obscene but not heard." Stinky is one smart man.
www.humanewatch.org
-
-
Two Headed Albino Bateater.
One year with Retics in house. I have 9. 6 of them contain albino genetics two visuals 4 hets. No none of them or amel or type II albino because its a pain to have to make males that specialized. But that has nothing to do with my background in genetics. No attacks today Wilomn it's pointless.
Sent from my iPhone using Tapatalk
-------------------------------------------------------
Retics are my passion. Just ask.
www.wildimaging.net www.facebook.com/wildimaging
"...That which we do not understand, we fear. That which we fear, we destroy. Thus eliminating the fear" ~Explains every killed snake"
-
-
Re: Two Headed Albino Bateater.
 Originally Posted by JLC
Nope... NormanSnake brought it up. I just posted the link he was referring to. 
Thanks for posting the vid. I'm on my phone so it's hard for me!
Sent from my Samsung Galaxy SIII using Tapatalk 2
-
-
Re: Two Headed Albino Bateater.
 Originally Posted by zeion97
I'm not sure ablut the whole albino genetics so that I have jo comment to, but this really looks like a high white albino retic.
I was not trying to say that the two-headed animal was absolutely a bat-eater, I do not have the knowledge to make that assessment and I gladly yield to others on that matter. All I was contending was that an Albino bat-eater could indeed occur.
 Originally Posted by reptileexperts
I didn't even bother to read his lesson since he believes I misused loci lol...
What a wonderfully enlightened point of view, someone points out that you do not understand something and rather than consider that they might, just may be, correct you instead take the attitude that they are the stupid one...
You did misuse loci, your own words betray you:
 Originally Posted by reptileexperts
All three albino phases fall on the same loci in Retics. Then the other two types are different as well, I.e, not compatible.
Right there you say that all three types of Albino in retics fall on the same loci and then you say that they are all different/not compatible. If they all fall on the same locus then they would be compatible. Since they are not compatible they do not fall on the same locus.
There are (I believe) three separate and distinct Albino loci in retics:
Purple/White
Type II
Green
 Originally Posted by reptileexperts
His point is moot since the species are not genetically similar enough to be compatible in albino crosses.
And this is just hogwash. The species are genetically similar enough to create a hybrid but they are not genetically similar enough for the hybrid to be Albino... The T-neg albino locus is the tyrosinase gene. Tyrosinase is tyrosinase is tyrosinase. Does not matter if it is in a retic or a Burm or a ball or a corn or a chondro or an iguana or a axolotl or a bullfrog or a budgie or a cat or a human. Same gene product in all of them and deleting it gives the same phenotype. If both parents lack the gene then the offspring will too. Basic genetics right there.
Last edited by asplundii; 04-15-2013 at 08:56 AM.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|