Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,281

0 members and 1,281 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,934
Threads: 249,129
Posts: 2,572,283
Top Poster: JLC (31,651)
Welcome to our newest member, LavadaCanc
Page 2 of 4 FirstFirst 1234 LastLast
Results 11 to 20 of 40
  1. #11
    No One of Consequence wilomn's Avatar
    Join Date
    05-18-2007
    Posts
    5,063
    Thanks
    123
    Thanked 2,795 Times in 1,171 Posts
    Images: 109

    Re: Two Headed Albino Bateater.

    Quote Originally Posted by reptileexperts View Post
    That is DEFINITELY a white phase albino retic. There is no way possible for a bateater to be albino because the alleles needed for Albino burmese and Albino retic do not sit on the same loci making it impossible for them to line up. However, if you cross a het albino bateater to a retic albino, you will get albinos that way, but those are no longer consider bat eaters. They look fine as far as being alive. Two handed animals survive . . . its not uncommon with some care.
    This may not be true. I have crossed an albino calking with an albino corn and gotten all albino babies. I doubt that snake could survive, it looked pretty deformed, but I don't doubt that it is an albino bateater.
    I may not be very smart, but what if I am?
    Stinky says, "Women should be obscene but not heard." Stinky is one smart man.
    www.humanewatch.org

  2. #12
    BPnet Lifer reptileexperts's Avatar
    Join Date
    03-26-2012
    Location
    Southeast Texas
    Posts
    2,334
    Thanks
    443
    Thanked 2,357 Times in 994 Posts
    Images: 1
    This is true. It's been tried and proven. There was a VERY recent discussion on this very topic on the Retic Nation site where many people have done bateater crosses, including albino x albino. It produced normal offspring.
    -------------------------------------------------------
    Retics are my passion. Just ask.

    www.wildimaging.net www.facebook.com/wildimaging

    "...That which we do not understand, we fear. That which we fear, we destroy. Thus eliminating the fear" ~Explains every killed snake"

  3. #13
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Two Headed Albino Bateater.

    Quote Originally Posted by reptileexperts View Post
    That is DEFINITELY a white phase albino retic. There is no way possible for a bateater to be albino because the alleles needed for Albino burmese and Albino retic do not sit on the same loci making it impossible for them to line up. However, if you cross a het albino bateater to a retic albino, you will get albinos that way, but those are no longer consider bat eaters. They look fine as far as being alive. Two handed animals survive . . . its not uncommon with some care.

    I am sorry but while your statement about an Albino burm x Albino retic breeding not resulting in Albino bat-eaters may be true your conclusion that "there is no way possible for a bat-eater to be Albino" is completely incorrect.

    A true T-neg Albino burm when bred to a true T-neg Albino retic would absolutely result in Albino bat-eaters because both parents would be missing the exact same gene; the tyrosinase gene.

    So the breeding you cite as being "proof" is not proof in any way, what it actually is is a case of either the Albino Burm or the Albino retic (or both) are actually a T-pos type Albino and give that there are at least three types (that I know of, and I am not a Burm or retic guy so maybe there are more) of Albino for both species then it is not unreasonable to expect non-compatible Albino types being crossed together.

    So the real question is: What type of Albino Burm and what type of Albino retic were bred in this instance versus what type of Albino Burm and what type of Albino retic were bred in the instance you cite. Without knowing those specifics you cannot rightly conclude that the animal pictured here is not an Albino bat-eater.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  4. #14
    BPnet Lifer reptileexperts's Avatar
    Join Date
    03-26-2012
    Location
    Southeast Texas
    Posts
    2,334
    Thanks
    443
    Thanked 2,357 Times in 994 Posts
    Images: 1

    Two Headed Albino Bateater.

    Again this was just discussed. All three albino phases fall on the same loci in Retics. Then the other two types are different as well, I.e, not compatible. Simple genetics to understand this. Not to mention then genus and species barrier given.


    Sent from my iPhone using Tapatalk
    -------------------------------------------------------
    Retics are my passion. Just ask.

    www.wildimaging.net www.facebook.com/wildimaging

    "...That which we do not understand, we fear. That which we fear, we destroy. Thus eliminating the fear" ~Explains every killed snake"

  5. #15
    BPnet Veteran OsirisRa32's Avatar
    Join Date
    11-11-2012
    Posts
    794
    Thanks
    318
    Thanked 165 Times in 136 Posts

    Re: Two Headed Albino Bateater.

    Quote Originally Posted by reptileexperts View Post
    That is DEFINITELY a white phase albino retic. There is no way possible for a bateater to be albino because the alleles needed for Albino burmese and Albino retic do not sit on the same loci making it impossible for them to line up. However, if you cross a het albino bateater to a retic albino, you will get albinos that way, but those are no longer consider bat eaters. They look fine as far as being alive. Two handed animals survive . . . its not uncommon with some care.
    even them sitting on different loci dont make it absolutely impossible.....just so unlikely that it might as well be impossible...unless of course they sit on entirely separate chromosomes as well which reduces the chances even further...
    1.1 Pinstripe - Orion/Eos
    1.1 Lessers - Typhon/Kali
    0.2 Dinkers - Stella & Wildfire
    1.0 Desert - No Name
    1.0 Het Red Axanthic - No name
    0.1 Woma- Cayenne
    0.1 Cinnamon- Nutmeg
    2.1 Mojave- No names
    1.0 Mystic- No Name
    0.1 Mahagony- No Name
    1.0 Black Pastel- No Name
    1.0 SD Tiger Retic- Thor
    0.0.1 Green Tree Python (Apollo)
    0.2 Labs- Daisy & Ruby

  6. #16
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Two Headed Albino Bateater.

    Quote Originally Posted by reptileexperts View Post
    Again this was just discussed. All three albino phases fall on the same loci in Retics. Then the other two types are different as well, I.e, not compatible. Simple genetics to understand this. Not to mention then genus and species barrier given.
    You are misusing the term "loci" in all of this and that is the first issue here.

    The three phases of Albino retic are 1) the Purple/White allele group 2) Green and 3) TypeII. Each of these phases is a mutant gene at a given locus. The Purple/White locus is completely unrelated to the Green is completely unrelated to the TypeII. If I breed a TypeII to a Purple I do not get an Albino I get double hets. These are totally different genes


    And in Burms you have 1) Albino 2) Purple Albino and 3) Green Albino. And just like above, the Albino locus is completely unrelated to the Purple is completely unrelated to the Green. And again, just like above if I breed a Green to a Purple I do not get an Albino I get double hets. These are totally different genes.


    Now, if I breed a Green Burm to a TypeII retic what do I get?? I do not know and neither do you because neither of us know if the Green gene in Burms is the same gene as the TypeII gene in retics. But, given what I do know about the genetics of Albinos in many animal species I feel it is pretty safe to say that these genes are different and so what we would get is double het bat-eaters

    And if I breed a typical Albino Burm to a White retic what do I get?? Again I do not know and neither do you because neither of us know if the Albino gene in Burms is the same gene as the White gene in retics. This one is a bit trickier because a Albino Burm and a White retic both appear to be T-neg types. But, again, given what I do know about the genetics of Albinos in many animal species I again feel comfortable saying that these genes, while phenotypically similar, are actually different and so what we would get is once again double het bat-eaters.

    Last one, if I breed a typical Albino Burm to a TypeII retic what do I get?? Again I do not know and neither do you because neither of us know if the Albino gene in Burms is the same gene as the TypeII gene in retics. And again, this one is tricky because a Albino Burm and a TypeII retic both appear to be T-neg types. But if they are both T-neg types then, instead of getting double het bat-eaters what you get is T-neg type Albino bat-eaters.


    So, once again, the important factor here is to know what types of Albino were used in the breeding you are citing versus they types of Albino used to create this two-headed animal. Because if you are talking about a Green Burm to a TypeII retic but this guy bred a Albino Burm to a TypeII retic then your citation is the apple and this guys breeding is the orange
    Last edited by asplundii; 04-12-2013 at 10:07 AM.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  7. The Following 4 Users Say Thank You to asplundii For This Useful Post:

    Archimedes (04-12-2013),Bluebonnet Herp (10-15-2013),HerpetualObscurity (10-17-2013),TheSnakeGeek (04-13-2013)

  8. #17
    BPnet Senior Member
    Join Date
    09-20-2012
    Location
    Mid. TN
    Posts
    1,634
    Thanks
    404
    Thanked 1,155 Times in 615 Posts

    Two Headed Albino Bateater.

    i love asplundii's genetic lessons. lol the guy did say it survived the hatch and is alive.. for now. interested to see if he can get it to eat. i know it's not likely. i don't know much about hybrids, but are deformities like this in hybrids a lot more common?

  9. #18
    BPnet Veteran zeion97's Avatar
    Join Date
    11-09-2011
    Location
    IL
    Posts
    804
    Thanks
    612
    Thanked 198 Times in 163 Posts
    Images: 3

    Re: Two Headed Albino Bateater.

    Quote Originally Posted by creepin View Post
    i love asplundii's genetic lessons. lol the guy did say it survived the hatch and is alive.. for now. interested to see if he can get it to eat. i know it's not likely. i don't know much about hybrids, but are deformities like this in hybrids a lot more common?
    I'm not sure ablut the whole albino genetics so that I have jo comment to, but this really looks like a high white albino retic.

    Id like to see more and the clutch mates. Any more pictures?
    1.0 Pied Ball Python (Rumple Stillkins) 2.0 Normal Ball (Simba) (legolas) 1.0 Pastel Ball (Isildur) 0.1 Normal Het? (Sarabi RIP 2013) 1.0 Burmese Python (Sephiroth) 0.1 Granite Burmese Python 1.0 Albino Burmese Python 1.0 Tiger Retic (Steve Irwin RIP 2012) 0.1 Lavender Albino Tiger (RIP 2012) 1.0 Spider Ball Python Spidey 1.0 Pewter Ball (pew pew) 0.1 Cinnamon Ball (Cinny) 1.0 Lavender Albino Retic (Old Yeller) 0.1 High Contrast Albino Retic (Sunshine) 0.1 BCI (Ruby)

    Here I Stand, The Black Sheep Of The Family, To you, Worth Less Then Zero. A Chef And A Reptile Lover. Yet, Reptiles Are Not A Hobby, But A Way Of Life.

  10. #19
    BPnet Veteran NormanSnake's Avatar
    Join Date
    12-10-2012
    Location
    Tulsa, Ok
    Posts
    848
    Thanks
    197
    Thanked 291 Times in 223 Posts

    Re: Two Headed Albino Bateater.

    I'm pretty sure that's a snake they showed on a prehistoricpets youtube vid.

    Sent from my Samsung Galaxy SIII using Tapatalk 2
    1.0 Normal
    1.0 Beardie

  11. The Following User Says Thank You to NormanSnake For This Useful Post:

    Bluebonnet Herp (10-15-2013)

  12. #20
    BPnet Veteran NormanSnake's Avatar
    Join Date
    12-10-2012
    Location
    Tulsa, Ok
    Posts
    848
    Thanks
    197
    Thanked 291 Times in 223 Posts

    Re: Two Headed Albino Bateater.

    Yeah, do a youtube search "two headed retic". I knew I had seen that snake somewhere.

    Sent from my Samsung Galaxy SIII using Tapatalk 2
    1.0 Normal
    1.0 Beardie

Page 2 of 4 FirstFirst 1234 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1