» Site Navigation
1 members and 1,776 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,069
Threads: 249,219
Posts: 2,572,796
Top Poster: JLC (31,651)
|
-
Re: Two Headed Albino Bateater.
 Originally Posted by reptileexperts
That is DEFINITELY a white phase albino retic. There is no way possible for a bateater to be albino because the alleles needed for Albino burmese and Albino retic do not sit on the same loci making it impossible for them to line up. However, if you cross a het albino bateater to a retic albino, you will get albinos that way, but those are no longer consider bat eaters. They look fine as far as being alive. Two handed animals survive . . . its not uncommon with some care.
This may not be true. I have crossed an albino calking with an albino corn and gotten all albino babies. I doubt that snake could survive, it looked pretty deformed, but I don't doubt that it is an albino bateater.
I may not be very smart, but what if I am?
Stinky says, "Women should be obscene but not heard." Stinky is one smart man.
www.humanewatch.org
-
-
This is true. It's been tried and proven. There was a VERY recent discussion on this very topic on the Retic Nation site where many people have done bateater crosses, including albino x albino. It produced normal offspring.
-------------------------------------------------------
Retics are my passion. Just ask.
www.wildimaging.net www.facebook.com/wildimaging
"...That which we do not understand, we fear. That which we fear, we destroy. Thus eliminating the fear" ~Explains every killed snake"
-
-
Re: Two Headed Albino Bateater.
 Originally Posted by reptileexperts
That is DEFINITELY a white phase albino retic. There is no way possible for a bateater to be albino because the alleles needed for Albino burmese and Albino retic do not sit on the same loci making it impossible for them to line up. However, if you cross a het albino bateater to a retic albino, you will get albinos that way, but those are no longer consider bat eaters. They look fine as far as being alive. Two handed animals survive . . . its not uncommon with some care.
I am sorry but while your statement about an Albino burm x Albino retic breeding not resulting in Albino bat-eaters may be true your conclusion that "there is no way possible for a bat-eater to be Albino" is completely incorrect.
A true T-neg Albino burm when bred to a true T-neg Albino retic would absolutely result in Albino bat-eaters because both parents would be missing the exact same gene; the tyrosinase gene.
So the breeding you cite as being "proof" is not proof in any way, what it actually is is a case of either the Albino Burm or the Albino retic (or both) are actually a T-pos type Albino and give that there are at least three types (that I know of, and I am not a Burm or retic guy so maybe there are more) of Albino for both species then it is not unreasonable to expect non-compatible Albino types being crossed together.
So the real question is: What type of Albino Burm and what type of Albino retic were bred in this instance versus what type of Albino Burm and what type of Albino retic were bred in the instance you cite. Without knowing those specifics you cannot rightly conclude that the animal pictured here is not an Albino bat-eater.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Two Headed Albino Bateater.
Again this was just discussed. All three albino phases fall on the same loci in Retics. Then the other two types are different as well, I.e, not compatible. Simple genetics to understand this. Not to mention then genus and species barrier given.
Sent from my iPhone using Tapatalk
-------------------------------------------------------
Retics are my passion. Just ask.
www.wildimaging.net www.facebook.com/wildimaging
"...That which we do not understand, we fear. That which we fear, we destroy. Thus eliminating the fear" ~Explains every killed snake"
-
-
Re: Two Headed Albino Bateater.
 Originally Posted by reptileexperts
That is DEFINITELY a white phase albino retic. There is no way possible for a bateater to be albino because the alleles needed for Albino burmese and Albino retic do not sit on the same loci making it impossible for them to line up. However, if you cross a het albino bateater to a retic albino, you will get albinos that way, but those are no longer consider bat eaters. They look fine as far as being alive. Two handed animals survive . . . its not uncommon with some care.
even them sitting on different loci dont make it absolutely impossible.....just so unlikely that it might as well be impossible...unless of course they sit on entirely separate chromosomes as well which reduces the chances even further...
1.1 Pinstripe - Orion/Eos
1.1 Lessers - Typhon/Kali
0.2 Dinkers - Stella & Wildfire
1.0 Desert - No Name
1.0 Het Red Axanthic - No name
0.1 Woma- Cayenne
0.1 Cinnamon- Nutmeg
2.1 Mojave- No names
1.0 Mystic- No Name
0.1 Mahagony- No Name
1.0 Black Pastel- No Name
1.0 SD Tiger Retic- Thor
0.0.1 Green Tree Python (Apollo)
0.2 Labs- Daisy & Ruby
-
-
Re: Two Headed Albino Bateater.
 Originally Posted by reptileexperts
Again this was just discussed. All three albino phases fall on the same loci in Retics. Then the other two types are different as well, I.e, not compatible. Simple genetics to understand this. Not to mention then genus and species barrier given.
You are misusing the term "loci" in all of this and that is the first issue here.
The three phases of Albino retic are 1) the Purple/White allele group 2) Green and 3) TypeII. Each of these phases is a mutant gene at a given locus. The Purple/White locus is completely unrelated to the Green is completely unrelated to the TypeII. If I breed a TypeII to a Purple I do not get an Albino I get double hets. These are totally different genes
And in Burms you have 1) Albino 2) Purple Albino and 3) Green Albino. And just like above, the Albino locus is completely unrelated to the Purple is completely unrelated to the Green. And again, just like above if I breed a Green to a Purple I do not get an Albino I get double hets. These are totally different genes.
Now, if I breed a Green Burm to a TypeII retic what do I get?? I do not know and neither do you because neither of us know if the Green gene in Burms is the same gene as the TypeII gene in retics. But, given what I do know about the genetics of Albinos in many animal species I feel it is pretty safe to say that these genes are different and so what we would get is double het bat-eaters
And if I breed a typical Albino Burm to a White retic what do I get?? Again I do not know and neither do you because neither of us know if the Albino gene in Burms is the same gene as the White gene in retics. This one is a bit trickier because a Albino Burm and a White retic both appear to be T-neg types. But, again, given what I do know about the genetics of Albinos in many animal species I again feel comfortable saying that these genes, while phenotypically similar, are actually different and so what we would get is once again double het bat-eaters.
Last one, if I breed a typical Albino Burm to a TypeII retic what do I get?? Again I do not know and neither do you because neither of us know if the Albino gene in Burms is the same gene as the TypeII gene in retics. And again, this one is tricky because a Albino Burm and a TypeII retic both appear to be T-neg types. But if they are both T-neg types then, instead of getting double het bat-eaters what you get is T-neg type Albino bat-eaters.
So, once again, the important factor here is to know what types of Albino were used in the breeding you are citing versus they types of Albino used to create this two-headed animal. Because if you are talking about a Green Burm to a TypeII retic but this guy bred a Albino Burm to a TypeII retic then your citation is the apple and this guys breeding is the orange
Last edited by asplundii; 04-12-2013 at 10:07 AM.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 4 Users Say Thank You to asplundii For This Useful Post:
Archimedes (04-12-2013),Bluebonnet Herp (10-15-2013),HerpetualObscurity (10-17-2013),TheSnakeGeek (04-13-2013)
-
Two Headed Albino Bateater.
i love asplundii's genetic lessons. lol the guy did say it survived the hatch and is alive.. for now. interested to see if he can get it to eat. i know it's not likely. i don't know much about hybrids, but are deformities like this in hybrids a lot more common?
-
-
Re: Two Headed Albino Bateater.
 Originally Posted by creepin
i love asplundii's genetic lessons. lol the guy did say it survived the hatch and is alive.. for now. interested to see if he can get it to eat. i know it's not likely. i don't know much about hybrids, but are deformities like this in hybrids a lot more common?
I'm not sure ablut the whole albino genetics so that I have jo comment to, but this really looks like a high white albino retic.
Id like to see more and the clutch mates. Any more pictures?
1.0 Pied Ball Python (Rumple Stillkins) 2.0 Normal Ball (Simba) (legolas) 1.0 Pastel Ball (Isildur) 0.1 Normal Het? (Sarabi RIP 2013) 1.0 Burmese Python (Sephiroth) 0.1 Granite Burmese Python 1.0 Albino Burmese Python 1.0 Tiger Retic (Steve Irwin RIP 2012) 0.1 Lavender Albino Tiger (RIP 2012) 1.0 Spider Ball Python Spidey 1.0 Pewter Ball (pew pew) 0.1 Cinnamon Ball (Cinny) 1.0 Lavender Albino Retic (Old Yeller) 0.1 High Contrast Albino Retic (Sunshine) 0.1 BCI (Ruby)
Here I Stand, The Black Sheep Of The Family, To you, Worth Less Then Zero. A Chef And A Reptile Lover. Yet, Reptiles Are Not A Hobby, But A Way Of Life.
-
-
Re: Two Headed Albino Bateater.
I'm pretty sure that's a snake they showed on a prehistoricpets youtube vid.
Sent from my Samsung Galaxy SIII using Tapatalk 2
-
The Following User Says Thank You to NormanSnake For This Useful Post:
-
Re: Two Headed Albino Bateater.
Yeah, do a youtube search "two headed retic". I knew I had seen that snake somewhere.
Sent from my Samsung Galaxy SIII using Tapatalk 2
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|