» Site Navigation
0 members and 639 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,905
Threads: 249,107
Posts: 2,572,117
Top Poster: JLC (31,651)
|
-
BPnet Veteran
-
-
Based on other pictures, I wouldn't say a very very low white Leopard Pied would be a completely outrageous claim. :u
Hopefully you'll get more opinions.
The Ball Pythons
0.1 2002 normal "Noodle", 1.0 2011 albino "Mosh", 0.1 2011 pinstripe "Pepper", 1.0 2009 lesser "Cato, 0.1 2010 spider "Phoebe", 1.0 2011 pastel 50% het. hypo "Toad", 0.1 2012 black pewter "Pomona", 0.1 2013 kingpin "Marvel", 0.0.7 lesserxspider eggs
The Others
0.1 2013 p. baroni "Hyacinth", 0.1 2013 CB g. oxycephala "Laurasia", 1.0 2013 T+ albino p. brongersmai "Reinhardt", 1.0 2012 CH g. oxycephala "Gondwana"
The Dearly Departed
0.1 2012-2013 hypo black pastel "Dexter"
-
-
x 2. It doesn't really look like a "normal" pied to me. The pattern is awesome either way. If the seller is claiming it's a leopard pied though, I would think he should be able to provide some sort of proof of it's genetics - ie: pics of the parents, etc.
-
The Following User Says Thank You to Evenstar For This Useful Post:
-
BPnet Veteran
-
-
Registered User
Re: Leopard Pied?
Don't know much about the morph but if you look towards the end of the snake there is a patch of white. May just be super low white. Could you ask the guy for some better photos?
Sent from my HTC One X using Tapatalk 2
0.0.1 RTB
1.0 Albino Burm
1.0 Pastel Ball
0.1.0 Normal Ball
Reef tank, amazonian tank
-
-
If I'm not mistaken the original leopards came from pieds, not that it means anything just mentioning it.
Is he advertising as leopard het pied or leopard pied?
As far as just leopard, yes I see leopard.
-
-
BPnet Veteran
-
-
I am inclined to say it is not a LeopardPied but is just a very low-white Pied
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Registered User
with the guy flip flopping about the genetics, if it was a female I'd go for it, but since you already have a male pied I'd pass.
Last edited by qegalpal; 03-28-2013 at 10:40 AM.
When the power of love overcomes the love of power,
then we will know peace. Jimi Hendrix
-
-
 Originally Posted by tikigator
Let me rephrase the question....is this a regular pied or a leopard pied? I know this is a low white pied but is there also leopard? Everything I have read and all research I have done (mostly on Bush League) says most leopard pieds are brighter, have high white (rarely if ever are low/no white) and have more dots/circles. I asked 2 breeders and they said it's just a regular pied but I wanted more input. Again...it's a big gamble should I decide to take it. Thanks!
Ok I see the white towards the end now. I would call it just a pied. The pied gene naturally whacks out patterns so it very well could be the case here.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|