Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 2,072

0 members and 2,072 guests
No Members online
Most users ever online was 54,199, 06-29-2026 at 02:43 AM.

» Today's Birthdays

None

» Stats

Members: 76,096
Threads: 249,238
Posts: 2,572,918
Top Poster: JLC (31,651)
Welcome to our newest member, JoRyMe
Page 1 of 2 12 LastLast
Results 1 to 10 of 11
  1. #1
    Registered User
    Join Date
    02-09-2013
    Posts
    2,385
    Thanks
    200
    Thanked 581 Times in 459 Posts

    question for the experts: is the Mahogany-morph in the Blue Eye Lucy complex?

    hi there

    im highly interested in this morph, because firstly its quite similar to cinnamon and black pastel, but the super-form, a nice very dark patternless snake, has no known genetic issues at all.

    but what im really curious about: Will this gene turn out to be part of the blue eye leucystic-complex, (together with butter/lesser, mojave, phantom/mystic, russo het leucystic and special) or not?

    the black potion (mahogany mojave) looks very similar to a mystic potion (mystic mojave), just much darker. Butter mojave also looks highly interesting and shows some characteristics of a dark mystic potion.

    so what would i get if i breed a black potion to a black potion?

    option 1, compatibility, same gene complex: 25% super mojave BEL 50% black potion 25% super mahogany.

    option 2, not the same gene complex: 6,25% normals, 12,5% mojave, 12,5% mahogany, 25% black potion, 12,5% super mahogany mojave, 12,5% mahogany super mojave, 6,25% super mahogany, 6,25% super mojave, 6,25% super mahogany super mojave.


    looking forward to your replies, oh and, to make it easier for you some links:

    mahogany base morph:
    http://www.worldofballpythons.com/morphs/mahogany/

    super mahogany:
    http://www.worldofballpythons.com/morphs/suma/

    black potion:
    http://www.worldofballpythons.com/morphs/black-potion/

    (for comparison mystic potion
    http://www.worldofballpythons.com/morphs/mystic-potion/

    butter mahogany:
    http://www.worldofballpythons.com/mo...tter-mahogany/

  2. The Following User Says Thank You to Pythonfriend For This Useful Post:

    Ronniex2 (08-07-2021)

  3. #2
    BPnet Veteran RoseyReps's Avatar
    Join Date
    07-07-2012
    Location
    Merritt Island, Florida
    Posts
    2,077
    Thanks
    1,300
    Thanked 1,230 Times in 689 Posts
    Images: 9
    No, I don't think it is part of the BEL complex. If anything it would be a part of the black pastel/cinni complex (IMO).

    Black Pastel x Mojave = http://www.worldofballpythons.com/mo...pastel-mojave/
    Mahogany x mojave = http://www.worldofballpythons.com/morphs/black-potion/
    Cinni x mojave = http://www.worldofballpythons.com/morphs/savannah-ball/ (See pic 2, as I don't know what the hell is going on with that "savannah" from nerd. I've never seen a savannah like that...lol)

    Those, are all very similar imo. Where as saying a mystic potion is like a lighter black potion would be as big of a jump/assumption to saying well a super black pastel is just a darker BEL... Making a huge jump like that, in either direction, just seems far fetched and unlikely.

    Though, the cinni mahogany does not lend itself to this theory, unless of course it is similar to how the mystic/phantom gene works with the other BEL genes (more pattern, still allelic)

    I would put my money, if it's allelic, with the cinni/bp complex over the BEL. But that's just my novice opinion

    Either way, I'm excited to see if the Cinni mahogany or the black potion for that matter, prove out to be allelic.

  4. #3
    Registered User
    Join Date
    02-09-2013
    Posts
    2,385
    Thanks
    200
    Thanked 581 Times in 459 Posts

    Re: question for the experts: is the Mahogany-morph in the Blue Eye Lucy complex?

    im just hoping that maybe someone has seen a clutch that could show it.

    and actually im hoping for a darkening gene, where the super is a black snake, to hit the BEL-complex.

    many scenarios to prove it or disprove it are possible. You breed cinny mahogany to normal and get a cinny mahogany or a normal: cinny and mahogany now proven not to be in the same gene complex. or you breed a mahogany mojave to a normal and hit another mahogany mojave, then you know its not in the BEL complex.

    basically, im looking for proof. something solid from actual breeding.

  5. The Following User Says Thank You to Pythonfriend For This Useful Post:

    Ronniex2 (08-07-2021)

  6. #4
    BPnet Veteran interloc's Avatar
    Join Date
    09-25-2011
    Location
    ontario canada
    Posts
    1,538
    Thanks
    331
    Thanked 627 Times in 410 Posts
    Images: 79

    question for the experts: is the Mahogany-morph in the Blue Eye Lucy complex?

    Your logic makes no sense to me. Do you know what leucistic means?

    Definition of leucistic
    adjective
    Zoology
    (of an animal) having whitish fur, plumage, or skin due to a lack of pigment.

    By definition an animal with a super that is black or dark brown cannot be leucistic or compatible with the blue eyed LEUCISTIC complex.

  7. The Following 2 Users Say Thank You to interloc For This Useful Post:

    Ronniex2 (08-12-2021),the_rotten1 (08-18-2019)

  8. #5
    BPnet Royalty OhhWatALoser's Avatar
    Join Date
    07-28-2007
    Location
    Suburbs of Detroit
    Posts
    4,986
    Thanks
    530
    Thanked 2,721 Times in 1,477 Posts
    Images: 2

    Re: question for the experts: is the Mahogany-morph in the Blue Eye Lucy complex?

    Quote Originally Posted by interloc View Post
    Your logic makes no sense to me. Do you know what leucistic means?

    Definition of leucistic
    adjective
    Zoology
    (of an animal) having whitish fur, plumage, or skin due to a lack of pigment.

    By definition an animal with a super that is black or dark brown cannot be leucistic or compatible with the blue eyed LEUCISTIC complex.
    Referring to the BEL complex doesn't mean everything in it is leucistic, just look at everything known to be a part of the complex....
    Butter
    Daddy Gene
    Lesser Platinum
    Mocha
    Mojave
    Mystic
    Phantom
    Russo Het Leucistic
    Special

    If the gene sits on the same locus, it is part of the same complex, looks have nothing to do with it.

    As for the OP, I havn't herd of mahogany being proven to be part of any complex yet, but if I was a betting man, I would put my money on the 8 ball complex.
    Last edited by OhhWatALoser; 03-07-2013 at 11:44 PM.

  9. The Following 4 Users Say Thank You to OhhWatALoser For This Useful Post:

    PartySnake13 (08-18-2019),REBELLMORPH (03-07-2013),Ronniex2 (08-07-2021),TopNotchPythons (08-29-2019)

  10. #6
    Registered User
    Join Date
    02-09-2013
    Posts
    2,385
    Thanks
    200
    Thanked 581 Times in 459 Posts
    i guess ill just try to ask BHB reptiles.

    when its in the same complex as cinnamon, het red axanthic and black pastel complex, that should be proven by now. but more likely its disproven by now.

    lets say you breed a cinnamon mahogany to a normal, or to something unrelated that wont interfere with the optics too much, like a clown or an albino. if you get a single snake that again looks like cinnamon mahogany, or a normal, its already clear that its not the same complex. and if its the same complex, half of the offspring is cinnamon and the other half is mahogany. I think such clutches have been hatched already, same goes for mahogany het red axanthic. i mean this is something Brian at BHB definitively must know, he has either disproven it or is in the process of proving it.


    proving that two genes are NOT in the same complex is easy. a 3-egg clutch with the right pairing can reveal that data. (so a single picture of a clutch, if its the right one with the right parents, can give a definitive answer that mahogany is not in the BEL complex). The opposite is harder to do.

    thanks for the helpful responses so far ill try contacting some big breeders working with the gene.

  11. #7
    BPnet Veteran
    Join Date
    11-13-2003
    Location
    Colorado
    Posts
    1,555
    Thanks
    6
    Thanked 247 Times in 186 Posts
    Images: 28
    Let us know what you find please, even if it's just that it hasn't been around long enough to know yet. I've wondered if it could be an allele of chocolate.

  12. #8
    Registered User Krynn's Avatar
    Join Date
    03-10-2011
    Location
    Winnipeg, Manitoba
    Posts
    105
    Thanks
    48
    Thanked 39 Times in 30 Posts
    I know im resurrecting this post, but do we know more about this gene yet?
    ---------------------------------------------------
    0.1 Lesser
    0.1 Wild Type
    0.1 Pastel
    1.0 Butter Enchi

    0.0.1 Childrens Python

  13. #9
    BPnet Veteran
    Join Date
    11-13-2003
    Location
    Colorado
    Posts
    1,555
    Thanks
    6
    Thanked 247 Times in 186 Posts
    Images: 28
    Do we know yet if Mahogany is allelic with any of the other mutations?

    I thought the Suma looked a lot like a super chocolate but I saw an animal advertised as a chocolate mahogany and it didn't look like either super.

  14. #10
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: question for the experts: is the Mahogany-morph in the Blue Eye Lucy complex?

    Quote Originally Posted by RandyRemington View Post
    Do we know yet if Mahogany is allelic with any of the other mutations?
    I have seen clutches from Mahogany Mojave that have produced both the combo and normals so that argues against them being allelic. Likewise, I have seen clutches from Mahogany Cinny that have produced both the combo and normals so, again, these are not allelic.


    Quote Originally Posted by RandyRemington View Post
    I thought the Suma looked a lot like a super chocolate but I saw an animal advertised as a chocolate mahogany and it didn't look like either super.
    Jake Milbrant has produced Chocolate Mahogany Sable animals. And since we know that you cannot have three copies of any allele we can conclude that Mahogany is not allelic to Chocolate/Sable


    For my money, if Mahogany will prove to be allelic with anything it will be the Copper morph out of Europe and the Cinder morph from Outback
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  15. The Following 3 Users Say Thank You to asplundii For This Useful Post:

    Alicia (09-22-2019),dr del (08-19-2019),Ronniex2 (08-12-2021)

Page 1 of 2 12 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1