Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,914

0 members and 1,914 guests
No Members online
Most users ever online was 54,199, 06-29-2026 at 02:43 AM.

» Today's Birthdays

None

» Stats

Members: 76,111
Threads: 249,259
Posts: 2,573,013
Top Poster: JLC (31,651)
Welcome to our newest member, MittieParris8
Page 2 of 3 FirstFirst 123 LastLast
Results 11 to 20 of 30
  1. #11
    Registered User
    Join Date
    02-09-2013
    Posts
    2,385
    Thanks
    200
    Thanked 581 Times in 459 Posts

    Re: Scaleless snakes

    i think when the heat pits are covered with skin like this, they are essentially gone. Infrared radiation can be effectively blocked by the thinnest paper you can imagine, and a layer of skin will do the job. And only the geometry of the pits allows ball pythons to detect the direction of incoming infrared radiation, for any directional sensing the pits need to be deep, essentially the derma-ball in the picture is half blind.

  2. #12
    Registered User gaiaeagle's Avatar
    Join Date
    06-07-2012
    Location
    Milwaukee, WI
    Posts
    165
    Thanks
    15
    Thanked 67 Times in 47 Posts
    I remember hearing about these when I was on a corn snake community. Personally, I don't like them. I would prefer mine to have scales. Just like the hairless cats. I prefer my cats to have fur (which I have three cats too). We dinker around with genetics so much, why do we need to breed for something so unnatural? I can understand why people think they are neat, but to me, it is kinda like looking at a freak show, and I feel sorry for the animal. Their skin has got to be more tender and more prone to injury and infections. I agree with what someone said above. It is one thing to save the life of one that was born without scales, it is another thing to selectively breed for it. I don't know. Just my two cents. This is one subject with snakes that I'll just agree to disagree about it.
    The collection is growing:
    1.0 Dumerils Boa (Khardeen), 0.1 Spider Ball Python (Charlotte), 0.1 Pastel Ball Python (Serenity), 1.1 Mojave Ball Python (Atreyu, Starr), 1.0 Black Pastel Ball python (Vader), 0.1 Enchi Champagne Ball Python (Monroe), 1.0 Enchi Ball Python (Apollo), 1.0 Citrus pastel yellowbelly ball python (Mellow Yellow), 1.1 Fire ball pythons (Fuego, Pele), 0.1 Pinstripe ball python (Vera), 1.0 Pastel Calico ball python (Monty the python), 1.0 X-Gene ball python (Wesley), 0.1 Butter X-Gene ball python (Buttercup), 0.1 Bumble Bee ball python (Honeycomb), 1.1 Red Blood Pythons (Armond, Mina), 1.1 Matrix Red Blood Python (no name, Trinity), 0.1 Splotched Sinaloan Milksnake (Lilith), 1.0 Albino Honduran Milksnake (Boros), 1.0 Desert Kingsnake (Crowley- King of Hell), 0.1 Banded Albino Kingsnake (Rhapsody)

  3. #13
    BPnet Veteran Cendalla's Avatar
    Join Date
    02-17-2011
    Location
    Washington State
    Posts
    1,525
    Thanks
    328
    Thanked 415 Times in 398 Posts
    Images: 33
    I know a lot of people won't agree with me and I'm not trying to create an argument but I really feel that we should be looking towards the preservation of these different species and purposely breeding in a flaw is counter productive. Yes, it is interesting. Yes, it is cool to learn whats going on. I just feel that that should be as far as it goes. Same for breeding with the mindset of having a cool color- what is the point when they are sterile or consistently produce unviable offspring? Anyways- not trying to pick a fight just my thoughts.
    0.1 Pastel Lesser Platinum (BP)
    0.1 Dumerils Boa
    0.1 Indian Sand Boa (Sunset)
    0.1 Kenyan Sand Boa (Anery)
    0.1 Kenyan Sand Boa (Rufescen)
    0.1 Kenyan Sand Boa (Paradox Albino)
    1.0 Kenyan Sand Boa (Paradox Snow)
    And a lot of Tarantulas

  4. #14
    BPnet Lifer Kodieh's Avatar
    Join Date
    01-04-2012
    Location
    Stillwater, OK
    Posts
    3,410
    Thanks
    2,097
    Thanked 1,432 Times in 920 Posts

    Re: Scaleless snakes

    Quote Originally Posted by Cendalla View Post
    I know a lot of people won't agree with me and I'm not trying to create an argument but I really feel that we should be looking towards the preservation of these different species and purposely breeding in a flaw is counter productive. Yes, it is interesting. Yes, it is cool to learn whats going on. I just feel that that should be as far as it goes. Same for breeding with the mindset of having a cool color- what is the point when they are sterile or consistently produce unviable offspring? Anyways- not trying to pick a fight just my thoughts.
    You almost had complete logic there. In fact, breeding for color at all is breeding in a flaw. Do honestly think that a banana or bee would survive in the wild? It can't hide!

    Sent from my SAMSUNG Galaxy SIII using Tapatalk 2

  5. The Following 2 Users Say Thank You to Kodieh For This Useful Post:

    Bluebonnet Herp (03-01-2013),Bogertophis (05-25-2018)

  6. #15
    BPnet Veteran satomi325's Avatar
    Join Date
    08-15-2011
    Location
    In a galaxy far,far away.
    Posts
    6,423
    Thanks
    2,429
    Thanked 3,969 Times in 2,446 Posts
    Images: 5

    Re: Scaleless snakes

    Quote Originally Posted by Kodieh View Post
    Do honestly think that a banana or bee would survive in the wild? It can't hide!

    Sent from my SAMSUNG Galaxy SIII using Tapatalk 2
    I'm not really aiming this at you, but just in general.

    I know everyone always talks about how the bright morphs can't survive in the wild due to lack of camouflage. But ball pythons are nocturnal and hide in burrows or termite mounds during the day where visibility is the best. So they generally are not out and about unless its dark. Bright pastels and some albinos are still found in Africa and are being imported. Even some adults. The first bannana and coral glows are imports. That has so say something right?

    Just my $.02.

    Sent from my DROID RAZR using Tapatalk 2
    Last edited by satomi325; 02-27-2013 at 02:18 PM.

  7. The Following User Says Thank You to satomi325 For This Useful Post:

    C.Marie (05-25-2018)

  8. #16
    BPnet Veteran Cendalla's Avatar
    Join Date
    02-17-2011
    Location
    Washington State
    Posts
    1,525
    Thanks
    328
    Thanked 415 Times in 398 Posts
    Images: 33

    Re: Scaleless snakes

    Quote Originally Posted by Kodieh View Post
    You almost had complete logic there. In fact, breeding for color at all is breeding in a flaw. Do honestly think that a banana or bee would survive in the wild? It can't hide!

    Sent from my SAMSUNG Galaxy SIII using Tapatalk 2
    Which is why I don't have a dozen as if they were pokemon. I won't lie- I have seen some retics that have made my go 'wow, ain't nature grand?' And then realize that nature has a tendency to cull that from the wild. Its man's (and/or woman's) intervention that has allowed it and nurtured it. Call it evolution or design but nature (in most cases) favors what can hide and hunt successfully. While we can help these morphs along to see its (arguable) potential I just can't see any reason to breed for something without scales or pits. I know the dollar (or whatever currency) is important at different degrees to everyone but I hate seeing people jump on a fad because they will make a quick buck. Its an emotional argument in the end because everyone can spout numbers and statistics to support their side. I'll just never put my money in that direction.

    Thank goodness I'm not up here trying to talk about crossbreeding. Because that argument is a bloody dang nightmare!
    0.1 Pastel Lesser Platinum (BP)
    0.1 Dumerils Boa
    0.1 Indian Sand Boa (Sunset)
    0.1 Kenyan Sand Boa (Anery)
    0.1 Kenyan Sand Boa (Rufescen)
    0.1 Kenyan Sand Boa (Paradox Albino)
    1.0 Kenyan Sand Boa (Paradox Snow)
    And a lot of Tarantulas

  9. #17
    BPnet Lifer Kodieh's Avatar
    Join Date
    01-04-2012
    Location
    Stillwater, OK
    Posts
    3,410
    Thanks
    2,097
    Thanked 1,432 Times in 920 Posts

    Re: Scaleless snakes

    Quote Originally Posted by satomi325 View Post
    I'm not really aiming this at you, but just in general.

    I know everyone always talks about how the bright morphs can't survive in the wild due to lack of camouflage. But ball pythons are nocturnal and hide in burrows or termite mounds during the day where visibility is the best. So they generally are not out and about unless its dark. Bright pastels and some albinos are still found in Africa and are being imported. Even some adults. The first bannana and coral glows are imports. That has so say something right?

    Just my $.02.

    Sent from my DROID RAZR using Tapatalk 2
    But are those officially WC or CH? I honestly find it hard to believe there is a real WC albino out there, at adult size (which for me is 1200g or better). CH I can believe, capture mom let her lay and then let her go, hatch out an albino and voila.

    Sent from my SAMSUNG Galaxy SIII using Tapatalk 2

  10. #18
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Scaleless snakes

    Quote Originally Posted by pythonminion View Post
    Boas and woma pythons do fine without heat pits.
    Many boas have heat pits. See this ETB: http://www.google.com/imgres?imgurl=...9QEwBA&dur=574

    Woma pythons (and Blackhead pythons) also have heat pits, they are just not as flagrant as those of other pythons

    Quote Originally Posted by Kurtilein View Post
    i think when the heat pits are covered with skin like this, they are essentially gone. Infrared radiation can be effectively blocked by the thinnest paper you can imagine, and a layer of skin will do the job. And only the geometry of the pits allows ball pythons to detect the direction of incoming infrared radiation, for any directional sensing the pits need to be deep, essentially the derma-ball in the picture is half blind.
    You are quite mistaken about these animals losing their ability to sense heat. I do not know why people assume that a lack of the physical "pit" means that the snake suddenly loses the ability to sense heat. The nerves for sensing heat are still present in a scale-less ball python and they still reside in the lip area. Losing the scales that define the pit has no impact on the nerves that are present in those areas. In point of fact the pits are the result of an evolutionary process to allow those nerves to be directly exposed and not be covered by scales while still offering a degree of protection to the underlying exposed skin. The snake in that picture is not "half blind" at all, in fact, if you look back at the picture you can make out the indentation of a couple of pits, on just below the nostril and one just forward of there. It can sense heat just fine.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  11. #19
    BPnet Senior Member Robyn@SYR's Avatar
    Join Date
    09-09-2009
    Location
    Denver, CO
    Posts
    1,525
    Thanks
    200
    Thanked 956 Times in 385 Posts

    Re: Scaleless snakes

    Quote Originally Posted by Kodieh View Post
    But are those officially WC or CH? I honestly find it hard to believe there is a real WC albino out there, at adult size (which for me is 1200g or better). CH I can believe, capture mom let her lay and then let her go, hatch out an albino and voila.
    There have been plenty of adult sized mutations found in the wild, including pieds and albinos.

    And personally, the scaleless thing is not for me.
    Last edited by Robyn@SYR; 02-27-2013 at 05:03 PM.

  12. The Following User Says Thank You to Robyn@SYR For This Useful Post:

    satomi325 (02-27-2013)

  13. #20
    BPnet Veteran Raven01's Avatar
    Join Date
    01-29-2013
    Location
    Peterborough, ON
    Posts
    854
    Thanks
    254
    Thanked 332 Times in 233 Posts
    Images: 2

    Re: Scaleless snakes

    Quote Originally Posted by Kodieh View Post
    You almost had complete logic there. In fact, breeding for color at all is breeding in a flaw. Do honestly think that a banana or bee would survive in the wild? It can't hide!

    Sent from my SAMSUNG Galaxy SIII using Tapatalk 2
    The first known white ball python was wild caught so, yeah it could survive.
    The "morphs" in BP's so far are pretty much all selective expression in greater quantity than normal of existing wild gene mutations.
    Also, breeding for preservation is a non-issue so long as accurate breeding records are kept. Then even hybrids are not a "problem" as those snakes would automatically be excluded from breeding programs aimed at re-introduction should some catastrophe suddenly kill off most wild BP's.

Page 2 of 3 FirstFirst 123 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1