» Site Navigation
1 members and 1,365 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,934
Threads: 249,129
Posts: 2,572,283
Top Poster: JLC (31,651)
|
-
Orange Dream and Enchi Question...
Has anyone tested whether or not the Orange Dream and Enchi are allelic/on the same locus? Anyone have an Enchi orange dream they've bred? Or, anyone that does, are they willing to share?
The enchi combos sure look a whole lot like OD combos to me... The super OD looks a lot like a super Enchi, and the Enchi OD looks like them, too. Just wondering if it's virtually different lines of the same mutation--with the difference of darkness/lightness like a dark normal vs. a light normal.
-
-
I don't think the super OD looks like the super enchi at all. The super OD spider doesn't look like the super enchi spider. The super OD fire also doesn't look like the super enchi fire. Not to me at least. The super OD seems more like a super clean animal. The super enchi stuff is kinda dirty and very different looking. They are definitely different mutations that do different things. If they are allelic, then I must get some OD because both make fantastic stuff.
 Originally Posted by reixox
BPs are like pokemon. you tell yourself you're not going to get sucked in. but some how you just gotta catch'em all.
-
The Following User Says Thank You to h00blah For This Useful Post:
-
Registered User
I see alot of difference in them just googling the different morphs.
That being said I still appreciate your OP because I had never taken the time to lookup a Super OD, and my god it is awesome
"Sorry, cant share my practices. I'm a ball whisperer...." -Mike41793
-
-
Re: Orange Dream and Enchi Question...
Just put a deposit on this OD Female so I have been doing a lot of reseach and there is an Orange Dream Enchi Combo and it is HOT! Here is my female:
Summary, they are not the same gene and that has been proven out

Here is an Enchi Orange Dream
http://www.worldofballpythons.com/mo...-orange-dream/
Here is the Triton I am working on (Orange Dream X Enchi X Firefly)

Here is her first partner: Iron Man Stinging Bumblebee PHOG
WTF Morphs
Current Projects: Arroyo, Black Pastel, Calico, Champagne, Cinnamon, Enchi, Fire, Jungle Woma,Leopard, Lesser/Butter, Mojave, Pastel, Spark (Het Puma), Specter (HetSuperstripe), Spotnose, Vanilla, Yellowbelly, Spider, Pinstripe, Nova, Axanthic(TSK), Clown, Genetic Stripe, Hypo Orange Ghost, Piebald
Like us on Facebook!
www.wtfmorphsofmanchester.com
www.facebook.com/wtfmorphsofmanchester
-
-
Registered User
Re: Orange Dream and Enchi Question...
 Originally Posted by h00blah
I don't think the super OD looks like the super enchi at all. The super OD spider doesn't look like the super enchi spider. The super OD fire also doesn't look like the super enchi fire. Not to me at least. The super OD seems more like a super clean animal. The super enchi stuff is kinda dirty and very different looking. They are definitely different mutations that do different things. If they are allelic, then I must get some OD because both make fantastic stuff.
There are thousands of genes in ball pythons that all contribute to the overall appearance of the snake (polymorphism). On WOBP it's important to remember that the pictures are just one example of the combo. Every snake will look different because you are not just comparing the genes in question, you are also comparing all the other genes that the individuals have that play into what the overall appearance looks like. I personally still believe that the orange dream and enchi are the same gene, but I don't think arguing the topic is beneficial to the trade.
-
-
Registered User
Re: Orange Dream and Enchi Question...
 Originally Posted by coolballsdave
There are thousands of genes in ball pythons that all contribute to the overall appearance of the snake (polymorphism). On WOBP it's important to remember that the pictures are just one example of the combo. Every snake will look different because you are not just comparing the genes in question, you are also comparing all the other genes that the individuals have that play into what the overall appearance looks like. I personally still believe that the orange dream and enchi are the same gene, but I don't think arguing the topic is beneficial to the trade.
I sorta regret the last sentence there. This thread was not posted to argue the topic of whether the orange dream and enchi are the same, so please disregard my last sentence. I'm totally with Clark though, I'd like to know if these two genes are different allele's on the same locus (in the same complex). Hopefully someone can shed light on this.
-
-
They are not allelic. Ozzy bred his OD/Enchi out last year and produced another OD/Enchi
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 6 Users Say Thank You to asplundii For This Useful Post:
C&H Exotic Morphs (02-06-2013),ClarkT (02-06-2013),coolballsdave (02-06-2013),dr del (02-06-2013),gsarchie (02-06-2013),h00blah (02-07-2013)
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|