Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,366

1 members and 1,365 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,934
Threads: 249,129
Posts: 2,572,283
Top Poster: JLC (31,651)
Welcome to our newest member, LavadaCanc
Results 1 to 7 of 7
  1. #1
    BPnet Veteran
    Join Date
    03-21-2010
    Location
    Roosevelt, Utah
    Posts
    1,123
    Thanks
    152
    Thanked 267 Times in 193 Posts
    Images: 303

    Orange Dream and Enchi Question...

    Has anyone tested whether or not the Orange Dream and Enchi are allelic/on the same locus? Anyone have an Enchi orange dream they've bred? Or, anyone that does, are they willing to share?

    The enchi combos sure look a whole lot like OD combos to me... The super OD looks a lot like a super Enchi, and the Enchi OD looks like them, too. Just wondering if it's virtually different lines of the same mutation--with the difference of darkness/lightness like a dark normal vs. a light normal.
    Lots of BPs, and still not enough!

    https://www.facebook.com/selectmorphs

    This is addictive...what did I get myself into?...

  2. #2
    BPnet Lifer h00blah's Avatar
    Join Date
    05-17-2009
    Posts
    5,686
    Thanks
    4,011
    Thanked 2,570 Times in 1,769 Posts
    Images: 2
    I don't think the super OD looks like the super enchi at all. The super OD spider doesn't look like the super enchi spider. The super OD fire also doesn't look like the super enchi fire. Not to me at least. The super OD seems more like a super clean animal. The super enchi stuff is kinda dirty and very different looking. They are definitely different mutations that do different things. If they are allelic, then I must get some OD because both make fantastic stuff.
    Quote Originally Posted by reixox View Post
    BPs are like pokemon. you tell yourself you're not going to get sucked in. but some how you just gotta catch'em all.

  3. The Following User Says Thank You to h00blah For This Useful Post:


  4. #3
    Registered User Griffith's Avatar
    Join Date
    01-26-2013
    Location
    Midwest
    Posts
    222
    Thanks
    47
    Thanked 89 Times in 64 Posts
    I see alot of difference in them just googling the different morphs.
    That being said I still appreciate your OP because I had never taken the time to lookup a Super OD, and my god it is awesome
    "Sorry, cant share my practices. I'm a ball whisperer...." -Mike41793




  5. #4
    BPnet Veteran Joshua Jasper's Avatar
    Join Date
    07-27-2012
    Location
    Manchester, NH
    Posts
    545
    Thanks
    36
    Thanked 304 Times in 170 Posts
    Images: 16

    Re: Orange Dream and Enchi Question...

    Just put a deposit on this OD Female so I have been doing a lot of reseach and there is an Orange Dream Enchi Combo and it is HOT! Here is my female:
    Summary, they are not the same gene and that has been proven out


    Here is an Enchi Orange Dream
    http://www.worldofballpythons.com/mo...-orange-dream/

    Here is the Triton I am working on (Orange Dream X Enchi X Firefly)


    Here is her first partner: Iron Man Stinging Bumblebee PHOG
    WTF Morphs
    Current Projects:
    Arroyo, Black Pastel, Calico, Champagne, Cinnamon, Enchi, Fire, Jungle Woma,Leopard, Lesser/Butter, Mojave, Pastel, Spark (Het Puma), Specter (HetSuperstripe), Spotnose, Vanilla, Yellowbelly, Spider, Pinstripe, Nova, Axanthic(TSK), Clown, Genetic Stripe, Hypo Orange Ghost, Piebald

    Like us on Facebook!
    www.wtfmorphsofmanchester.com
    www.facebook.com/wtfmorphsofmanchester

  6. #5
    Registered User coolballsdave's Avatar
    Join Date
    04-29-2010
    Location
    Roosevelt, Utah
    Posts
    196
    Thanks
    72
    Thanked 62 Times in 44 Posts
    Images: 1

    Re: Orange Dream and Enchi Question...

    Quote Originally Posted by h00blah View Post
    I don't think the super OD looks like the super enchi at all. The super OD spider doesn't look like the super enchi spider. The super OD fire also doesn't look like the super enchi fire. Not to me at least. The super OD seems more like a super clean animal. The super enchi stuff is kinda dirty and very different looking. They are definitely different mutations that do different things. If they are allelic, then I must get some OD because both make fantastic stuff.
    There are thousands of genes in ball pythons that all contribute to the overall appearance of the snake (polymorphism). On WOBP it's important to remember that the pictures are just one example of the combo. Every snake will look different because you are not just comparing the genes in question, you are also comparing all the other genes that the individuals have that play into what the overall appearance looks like. I personally still believe that the orange dream and enchi are the same gene, but I don't think arguing the topic is beneficial to the trade.

  7. #6
    Registered User coolballsdave's Avatar
    Join Date
    04-29-2010
    Location
    Roosevelt, Utah
    Posts
    196
    Thanks
    72
    Thanked 62 Times in 44 Posts
    Images: 1

    Re: Orange Dream and Enchi Question...

    Quote Originally Posted by coolballsdave View Post
    There are thousands of genes in ball pythons that all contribute to the overall appearance of the snake (polymorphism). On WOBP it's important to remember that the pictures are just one example of the combo. Every snake will look different because you are not just comparing the genes in question, you are also comparing all the other genes that the individuals have that play into what the overall appearance looks like. I personally still believe that the orange dream and enchi are the same gene, but I don't think arguing the topic is beneficial to the trade.
    I sorta regret the last sentence there. This thread was not posted to argue the topic of whether the orange dream and enchi are the same, so please disregard my last sentence. I'm totally with Clark though, I'd like to know if these two genes are different allele's on the same locus (in the same complex). Hopefully someone can shed light on this.

  8. #7
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    They are not allelic. Ozzy bred his OD/Enchi out last year and produced another OD/Enchi
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  9. The Following 6 Users Say Thank You to asplundii For This Useful Post:

    C&H Exotic Morphs (02-06-2013),ClarkT (02-06-2013),coolballsdave (02-06-2013),dr del (02-06-2013),gsarchie (02-06-2013),h00blah (02-07-2013)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1