Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,942

0 members and 1,942 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,079
Threads: 249,221
Posts: 2,572,814
Top Poster: JLC (31,651)
Welcome to our newest member, Snaketammer28
Page 2 of 2 FirstFirst 12
Results 11 to 17 of 17

Thread: BP Gene Study

  1. #11
    BPnet Royalty OhhWatALoser's Avatar
    Join Date
    07-28-2007
    Location
    Suburbs of Detroit
    Posts
    4,986
    Thanks
    530
    Thanked 2,721 Times in 1,477 Posts
    Images: 2

    Re: BP Gene Study

    Quote Originally Posted by mainbutter View Post
    Injecting isn't the best term to describe it, but DNA splicing is most certainly real. Typically this kind of thing is done in the classroom with bacterium.
    Glo-fish!

    Now let's make neon colored bp

  2. The Following User Says Thank You to OhhWatALoser For This Useful Post:

    jermajestyg (01-04-2013)

  3. #12
    Registered User Snake Den's Avatar
    Join Date
    11-25-2012
    Location
    Auburn, AL
    Posts
    135
    Thanks
    88
    Thanked 62 Times in 30 Posts
    Images: 8

    Re: BP Gene Study

    I am in veterinary school and have taken a few genetics classes. I have always wondered about this, and I think it would be an awesome project. Here is how I would approach it, though realize I am not an expert on the subject, so excuse me for any errors in judgement! I would use the GWAS approach (Genome Wide Association Study). You would need a very large amount of balls though. First I would sequence a whole bunch of normals (your control group). I would probably pick a recessive morph next since the mutation is likely to be a simple singe gene mutation (albino is perfect- I believe "albino" is caused by a problem with making eumelanin although the animal can still make pheomelanin- beside the point but very interesting!). I would sequence a bunch of albinos and then use computers to compare the genes of the two. You could essentially use this technique on any morph, but in the time you have I would limit it to one simple morph to start. Maybe it would make some good research once you get into the University (because you will!). Anyway, if you know the sequence and can pin point the exact locus of the gene in question, it opens so many doors to other research possibilities...

    Good luck! I envy your potential research
    2.0 Normal BP (Gucci, Louis Vutton)
    1.0 Albino BP (Armani)
    1.0 Bumblebee BP (Diesel)
    1.0 Het Pied/Het Albino BP (Tommy Hilfiger)
    1.0 Cinnamon BP
    1.0 Fire BP (Burberry)
    1.0 Special BP (Guess)
    1.0 Green Pastel BP
    0.1 Pied BP (Dolce)
    0.1 Butter BP (Bentley)
    0.1 Dinker BP (DKNY)
    0.1 Mystic Potion BP (Prada)
    0.1 Albino Spider BP (Juicy Couture)
    0.1 Yellow Belly BP (Salvatore)
    0.1 Pastel Enchi BP
    0.0.4 Dinker BP Hatchlings

    1.0 Hypo Het Albino Redtail Boa (Excalibur)
    1.0 Taco Terrier (Smudge)
    1.0 Swedish Warblood (Manhattan)
    0.0.2 Frogs (Sartorius and Nissl)
    0.0.1 Slimy Salamander
    1.0 Better half

  4. #13
    BPnet Veteran OsirisRa32's Avatar
    Join Date
    11-11-2012
    Posts
    794
    Thanks
    318
    Thanked 165 Times in 136 Posts

    Re: BP Gene Study

    Quote Originally Posted by jermajestyg View Post
    Hey Everyone,

    My name is Jeremy Giampaoli and I'm a junior in high school. I'm planning on applying to Stanford and realize that I need something to stand out on my application and was pondering the idea of an experiment on ball python genetics. I have access to a fairly high quality private company's laboratory (obviously not billions of dollars of equipment) but should have most of machines I'll be needing. This is just in the development stage and I had some questions to see if my dream could become a real experiment.

    1) Has anyone done an in-depth experiment on ball python genetics before? Not just a normal dom, co-dom, recessive trait test, but identifying the chromosomes and gene changes between different morphs?

    2) Can anyone with scientific experience tell me if it's possible to extract DNA from two different morphs of BP and be able to identify the discrepancies? Also, if identified, would injecting them into, lets say, a normal BP change the phenotype or genotype of the animal?

    3) Would any breeder (or anyone for that matter) in the Southern California area (I'm in Torrance) potentially be willing to loan me a few ball pythons? If I follow through with this project, I would test out the experiment on my own normal BP as long as it is safe. I was thinking just a few simple morphs (dom, co-dom, and recessive) like spider, lesser, and albino or something of the like. If successful, then possibly moving on to two gene animals.

    Thanks in advance for your input,

    Jeremy Giampaoli
    Jeremy,
    yes it is all possible however several issues stand in your way.

    1) The ball python genome has not yet been sequenced....this would require thousands if not tens of thousands of dollars plus months to years to complete.
    2) without the genome having been sequenced yet there would be NO place to know where to start in regards to figuring specific genes out.
    3) many many many phenotypes that we see in other animals including humans are multifactorial when it comes to a gene or multiple gene's influences.
    4) you also would need to completely map out not just the genes but the on and off switches for genes....this includes temperature dependent gene expression, biochemical pathway modeling in vitro on top of a few other issues.
    5) this entire undertaking would require millions of dollars, countless snakes (and you would have to prove you were abiding by federal,state, and local animal experimental laws and regulations) as well as years of research on all of this.
    6) the discrepancies found between a normal and a normal would still not even be provable or completely revealing in the ways you are hoping for.
    7) injecting an animal with manipulated genetic material is genetic engineering, you run into many ethical and moral issues there....on top of the fact that reptiles are slow growing (relative to many of the genetic engineering organisms used today) and you would have to find a way to ensure that whatever material you inject somehow makes it into every cell in the snakes body in order for it to alter its phenotype and genotypes completely....you are better off focusing on manipulating the germ line cells as they represent the directly inheritable material for the next generation...but also realize biological sex in reptiles is not a XX or XY system like in most mammals.

  5. #14
    BPnet Veteran OsirisRa32's Avatar
    Join Date
    11-11-2012
    Posts
    794
    Thanks
    318
    Thanked 165 Times in 136 Posts
    Also realize some of the genetic material in every species is actually due to retro type viruses that have co-evolved with that species over tens of thousands or millions of years...this will also affect the genetic and genome information and its outcome....some of the material shows up in introns....some does not.

  6. #15
    Registered User
    Join Date
    11-08-2012
    Posts
    2
    Thanks
    4
    Thanked 0 Times in 0 Posts
    Ironically, i have been pretty busy with school and been on two vacations and am finally getting back to this haha. Just for your information, I'm not (potentially) doing this expecting a fast track to an Ivy League, just as an extra on my app (which i would probably include in my essay). I have a 4.5 GPA and have done many extra curricular activities including 7 varsity letters in 3 different sports and thousands of hours of community service type stuff.

    From all the info you guys have provided, it looks like an in-depth, long term experiment is out of the question, unless i am going to pursue it throughout college. Obviously, i dont have millions of dollars and nobel prize winning scientists so i may not be able to map out the entire genome, or even a part. Would there be any way to "dumb it down"? Im not really sure how I would do that because like OsirisRa said, the original experiment of finding the DNA change in morphs would include thousands of animals and is not realistic with just one or two of each morph. Just wondering if anyone had an idea to change the experiment or even have an entirely new experiment that has to do with BP's. I might pursue an entirely different experiment, but would love to include the snakes i love .

    Thanks for all the input,
    -Jeremy

  7. #16
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    A simple genetics experiment you could potentially do is the characterization of a single morph gene. I would agree with Snake Den on using the Albino locus but I would do it the old old fashioned way and skip any prospect of GWAS or anything fancy. It might still be a bit pricy (most lab work is) but if you have access to a lab that is set up for basic PCR and DNA gel electrophoresis then it should not be something out of the realm of possibility.

    If you would like further detail on how to set something up feel free to ping me
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  8. #17
    BPnet Veteran
    Join Date
    08-31-2011
    Posts
    649
    Thanks
    193
    Thanked 428 Times in 263 Posts
    Images: 21

    Re: BP Gene Study

    One project I'd like to see someone do is cat scans or sequential sections on microscope slides of a normal ball python head and a spider head. That might help narrow down just what is the cause of the spider head twisting. Inner ear problem? Abnormal part of the brain? It's not as sexy as genome sequencing, though.

Page 2 of 2 FirstFirst 12

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1