Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 553

0 members and 553 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,916
Threads: 249,118
Posts: 2,572,200
Top Poster: JLC (31,651)
Welcome to our newest member, Wilson1885
Page 5 of 6 FirstFirst 123456 LastLast
Results 41 to 50 of 51
  1. #41
    BPnet Royalty OhhWatALoser's Avatar
    Join Date
    07-28-2007
    Location
    Suburbs of Detroit
    Posts
    4,986
    Thanks
    530
    Thanked 2,721 Times in 1,477 Posts
    Images: 2
    before this thread I was not aware of any of your previous dealing with it, if I was a member when this happened... i missed it completely, sorry. I was also completely unaware there are people who are in denial of it. As I stated above, I have seen it first hand (or IBD like symptoms, it wasn't actually diagnosed) so it strikes me just as odd to hear that, as it must of struck you at the time. I can see where your frustration would come from, taking a lashing for telling the truth. There does seem to be a few who are put on a God Pedestal and what they say is law, regardless of the facts.

    Knowing all this now, I can completely understand. You have to admit though, for those of us out of the loop it was pretty damn confusing.

  2. #42
    BPnet Lifer Skiploder's Avatar
    Join Date
    03-03-2007
    Location
    Under a pile of wood.
    Posts
    3,580
    Thanks
    113
    Thanked 3,727 Times in 1,257 Posts
    Images: 1

    Re: IBD possibly caused by newly discovered rodent virus!

    Quote Originally Posted by OhhWatALoser View Post
    before this thread I was not aware of any of your previous dealing with it, if I was a member when this happened... i missed it completely, sorry. I was also completely unaware there are people who are in denial of it. As I stated above, I have seen it first hand (or IBD like symptoms, it wasn't actually diagnosed) so it strikes me just as odd to hear that, as it must of struck you at the time. I can see where your frustration would come from, taking a lashing for telling the truth. There does seem to be a few who are put on a God Pedestal and what they say is law, regardless of the facts.

    Knowing all this now, I can completely understand. You have to admit though, for those of us out of the loop it was pretty damn confusing.
    People still deny it and others refuse to believe that there is a possibility that a certain percentage of boas may be infected but remain asymptomatic indefinitely. On one of the forums, there was a gang of moderators who threatened me with infractions. On another (a Canadian one), the site admin blocked all of my posts for review until I emailed him scans of the various tests and vet reports that were done. Then he thanked me and banned me.

    When interviewed, IBD researchers are pretty open with their scorn at the lack of support from the boa community.

    There was a subset of people who openly recognized IBD existed but told me that the information I was passing along regarding that it could manifest itself as a series of subclinical issues or not manifest at all was scare mongering. Even when I shared e-mails between the staff at UCD and Dr. Jacobson they still openly argued with me.

    So while some people are amazed that there is a sub-sect of deniers out there, I maintain that they are still in some form of denial. The very fact that IBD research is so poorly funded points to that.

    The cynical part of me wonders how long this breakthrough would have taken if the Academy of Sciences hadn't had an outbreak....................

  3. #43
    BPnet Senior Member
    Join Date
    07-27-2009
    Location
    Phoenix, AZ
    Posts
    2,522
    Thanks
    827
    Thanked 708 Times in 504 Posts
    Images: 29
    So what's motivating the denial? I understand that it's easy to form conflicting opinions when most of the evidence is anecdotal, and different anecdotes have different endings, because it manifests widely differently in different animals... but the large scale denial, what's driving that?

    Is it the fact python owners are basically a large population of potential future boa buyers, and this is terrible press for boas? So every time another python owner's collection is devastated by IBD, the boa people groan inwardly the same we groan whenever another dumb monster python owner gets strangled by his african rock, or another huge Burmese is found under somebody's house?
    -Jackie Monk

  4. #44
    BPnet Lifer Skiploder's Avatar
    Join Date
    03-03-2007
    Location
    Under a pile of wood.
    Posts
    3,580
    Thanks
    113
    Thanked 3,727 Times in 1,257 Posts
    Images: 1

    Re: IBD possibly caused by newly discovered rodent virus!

    Quote Originally Posted by loonunit View Post
    So what's motivating the denial? I understand that it's easy to form conflicting opinions when most of the evidence is anecdotal, and different anecdotes have different endings, because it manifests widely differently in different animals... but the large scale denial, what's driving that?

    Is it the fact python owners are basically a large population of potential future boa buyers, and this is terrible press for boas? So every time another python owner's collection is devastated by IBD, the boa people groan inwardly the same we groan whenever another dumb monster python owner gets strangled by his african rock, or another huge Burmese is found under somebody's house?
    Well, I would hazard a guess that money is a driving force.

    I mean, if some of the comments made by researchers are correct and that many of the boas donated for research were shown to be asymptomatic carriers and I think it was the Merck Manual that stated that upwards of half the boas necropsied for non-IBD issues were found to be carriers.

    So, if you are a boa breeder, what are your options? You've got people researching the disease saying that upwards of 1/3 to 1/2 of all boas may be asymptomatic carriers. Whether that is accurate or not, or whether or not only a small percentage of those animals become sick or are capable of infecting other snakes, and considering there is not a 100% accurate screening test on live animals, how do you assure people your collection is free of the disease?

    At that point if you acknowledge the possibilities and acknowledge the Merck statistics and the earlier Belgian study and take Dr. Jacobson at his word, you acknowledge that you run a large statistical chance of selling someone a snake that is a carrier. Remember, you can't say your collection is really clear.......can you?

    So for years the mantra was that if IBD was acknowledged that it struck down pythons lightning quick and boas showed neurological symptoms. Now, we've had Dr. Jacobson and others repeatedly state that pythons may be able to go just as long as boas in terms of being asymptomatic and that it often manifests itself as a series of subclinical infections ranging from mouth rot to anorexia to chronic RIs.

    Some people still stubbornly cling to the old facts, regardless of what is published.
    Last edited by Skiploder; 08-16-2012 at 10:51 PM.

  5. #45
    BPnet Senior Member
    Join Date
    07-27-2009
    Location
    Phoenix, AZ
    Posts
    2,522
    Thanks
    827
    Thanked 708 Times in 504 Posts
    Images: 29
    So then I'd also like to know what fraction of captive pythons are also "asymptomatic" carriers.

    ... but leaving that aside, and still assuming IBD originated with boas, it also means that any imported boas are pretty likely to have it.

    We need a better blood test. Resistance from the boa community, yeah, I know, but this could turn out to just be something boas and boa owners have to live with, like toxoplasmosis and FIV in cats.
    -Jackie Monk

  6. #46
    BPnet Lifer Skiploder's Avatar
    Join Date
    03-03-2007
    Location
    Under a pile of wood.
    Posts
    3,580
    Thanks
    113
    Thanked 3,727 Times in 1,257 Posts
    Images: 1

    Re: IBD possibly caused by newly discovered rodent virus!

    Quote Originally Posted by loonunit View Post
    So then I'd also like to know what fraction of captive pythons are also "asymptomatic" carriers.

    ... but leaving that aside, and still assuming IBD originated with boas, it also means that any imported boas are pretty likely to have it.

    We need a better blood test. Resistance from the boa community, yeah, I know, but this could turn out to just be something boas and boa owners have to live with, like toxoplasmosis and FIV in cats.
    Alex (Kitedemon) has also corresponded with Dr. Jacobson. I can't remember the exact details of the e-mail, but the general gist was that they didn't have anything indicating that pythons go quickly or what % were even carriers.

    That pretty much mirrors my correspondence with him in which many of the old assumptions were casually swatted away. What I would suggest is that you email that question to Dr. J - I don't know one person who he hasn't quickly returned an e-mail to.

    In one of my email's strings with a vet at UCD, he made a comment that they just weren't seeing the same IBD numbers in pythons and that there were several python species (antaresia/aspidites included) that, as far as he knew, had never tested positive for the virus.
    Last edited by Skiploder; 08-17-2012 at 02:12 AM.

  7. #47
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: IBD possibly caused by newly discovered rodent virus!

    Quote Originally Posted by Skiploder View Post
    I'll go ahead and drop my knife and hold out my hand to Travis or anyone else I've snapped at in this thread. IBD is deadly serious to me. I had to euthanize long term animals I cared about and had to sacrifice more for testing. I spent a long stretch of time in constant dread of walking into the snake house and more importantly, my faith in this community plummeted. I saw people who were more concerned that by me sharing my experiences, that it would hurt their bottom line. When I heard from the IBD researchers that the boa community was literally not supporting their research, I decided that I was done with boids and the subset of hypocritical jackasses who seemed to be their voice at the time.
    Skip,

    Seems I went off half-cocked.

    I accept your hand and I hold out mine in return. Forgive and forget?

    You say you were being obviously sarcastic, and with the further background you provided I believe that. When your post was called to my attention however I did not read sarcasm. What I read was the snark and condescension that I hear from people who have taken a hard-core stance against something and evidence be damned (kind of the way you say elements of the boa community have done.) Blame it on the lack of context in the typed words on a forum, that is what I saw. And that rankled me, tow-fold; I have not had the misfortune of IBD but I had a buddy that lost a huge number of animals to it and, as a scientist myself, I get a bit defensive when people slam scientist under the guise of "science is evil and scientists lie just to promote their own lies." Your post came off to me as a disrespect for people like my friend and a disrespect of my cohorts. In your initial reply to my post you called me a "humorless twit". You are half-right, I take IBD as deadly serious as you. But, where as you respond with sarcasm and humor, I take a wholly humorless stance. I did not see your post as a "joke" so I did not reply as if it was a "joke". As for the "twit" half... I have been called worse in my days, and will probably be called worse in the future.

    Again, my apologies for coming down like a tonne of bricks.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  8. #48
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: IBD possibly caused by newly discovered rodent virus!

    Quote Originally Posted by Skiploder View Post
    So, if you are a boa breeder, what are your options? You've got people researching the disease saying that upwards of 1/3 to 1/2 of all boas may be asymptomatic carriers. Whether that is accurate or not, or whether or not only a small percentage of those animals become sick or are capable of infecting other snakes, and considering there is not a 100% accurate screening test on live animals, how do you assure people your collection is free of the disease?

    At that point if you acknowledge the possibilities and acknowledge the Merck statistics and the earlier Belgian study and take Dr. Jacobson at his word, you acknowledge that you run a large statistical chance of selling someone a snake that is a carrier. Remember, you can't say your collection is really clear.......can you?
    Quote Originally Posted by loonunit View Post
    We need a better blood test.
    The tests that were developed as part of this study are very robust and can easily be developed into a commercially available test that should not cost overly much. And if these researchers perform a few other experiments (like perhaps a couple of deep sequences) they can probably refine the tests to be even more sensitive and accurate. Right now it is more a matter of finding someone willing to set up a "company" to perform the tests commercially...

    Quote Originally Posted by loonunit View Post
    Resistance from the boa community, yeah, I know, but this could turn out to just be something boas and boa owners have to live with, like toxoplasmosis and FIV in cats.
    I would contend that it is a little bit different. With cats and toxo (or FIV) you only have to worry about the immunocompromised and other cats and toxo is not a problem for cats and there is a vaccine for FIV... With IBD, you cannot really protect you other animals. There is no vaccine, no treatment. And IBD has the potential to be damaging to any animal it infects. Just because some animals are asymptomatic carriers does not mean that you can predict or safely bank on your animals becoming asymptomatic carriers instead of fatality cases
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  9. #49
    Registered User
    Join Date
    06-25-2012
    Posts
    103
    Thanks
    11
    Thanked 32 Times in 19 Posts
    Images: 3
    Hmmm....spread by rodents, or spread by mites/other blood-sucking parasites? Rodents may be carriers as well, but are they the prime source of infection for snakes in this case? I'm reminded of the bubonic plague, which while thought to be carried by rats originally was actually transmitted by fleas. Both of the viruses (and potentially the third) identified in this study are related to viruses that have either unknown sources or appear to be carried by rodents. You could test it but ultimately if it's mites or rodents or both that are hosts, what will the community do? It's not like there's a synthetic option to feed instead of rodents, and mites aren't going to go away anytime soon. The easiest thing to happen is that feeder companies start getting their colonies screened for these viruses and certifying if they're clean or not. I'm not actually sure if companies like that are required to have sentinels and do regular screening....I would certainly hope so....but if they don't post their health records for their colonies maybe it's something to start encouraging them to do. That way people can be assured the feeders they're getting are clean. It may, as asplundii has noted, be possible to come up with an inexpensive test that breeders and owners can use to ensure their animals are clean, and if such a test becomes available and people can start demanding that breeders certify their animals are clean. However, we still don't know if these are the only two (maybe three) viruses responsible for causing IBD....or if that is the exact cause of IBD, two of the animals in the study tested negative for viruses.

  10. #50
    BPnet Lifer Skiploder's Avatar
    Join Date
    03-03-2007
    Location
    Under a pile of wood.
    Posts
    3,580
    Thanks
    113
    Thanked 3,727 Times in 1,257 Posts
    Images: 1

    Re: IBD possibly caused by newly discovered rodent virus!

    Quote Originally Posted by asplundii View Post
    Skip,

    Seems I went off half-cocked.

    I accept your hand and I hold out mine in return. Forgive and forget?

    You say you were being obviously sarcastic, and with the further background you provided I believe that. When your post was called to my attention however I did not read sarcasm. What I read was the snark and condescension that I hear from people who have taken a hard-core stance against something and evidence be damned (kind of the way you say elements of the boa community have done.) Blame it on the lack of context in the typed words on a forum, that is what I saw. And that rankled me, tow-fold; I have not had the misfortune of IBD but I had a buddy that lost a huge number of animals to it and, as a scientist myself, I get a bit defensive when people slam scientist under the guise of "science is evil and scientists lie just to promote their own lies." Your post came off to me as a disrespect for people like my friend and a disrespect of my cohorts. In your initial reply to my post you called me a "humorless twit". You are half-right, I take IBD as deadly serious as you. But, where as you respond with sarcasm and humor, I take a wholly humorless stance. I did not see your post as a "joke" so I did not reply as if it was a "joke". As for the "twit" half... I have been called worse in my days, and will probably be called worse in the future.

    Again, my apologies for coming down like a tonne of bricks.
    Travis:

    As someone who was more than ticked at the deniers, I get why you got upset. Trust me, I get it.

    I'm more than happy to shake your hand...................and give you a bear hug to boot.

    Craig
    Last edited by Skiploder; 08-19-2012 at 02:08 PM.

Page 5 of 6 FirstFirst 123456 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1