Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 709

0 members and 709 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,899
Threads: 249,097
Posts: 2,572,069
Top Poster: JLC (31,651)
Welcome to our newest member, wkeith67
Results 1 to 2 of 2

Thread: Woma het Albino

  1. #1
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Woma het Albino

    I have 3.2 Woma het Albino available.

    The Woma morph is really under-rated but some great stuff has been produced with it in the past year. To the best of my knowledge this is only the second clutch of Woma het Albino produced to date and the first time they have been produced in the US. These have all the characteristics you want for a great high contrast Albino project: Deep blacks, very little blushing, bright gold patterning. Albino sire is from Tom Keogan and is still extremely high contrast after three years (pics available).


    Asking $1050 for males, $1200 for females. I would prefer PayPal but will accept check or money order (animal held until payment clears). Shipping via SYR, cost is included in the price. I would also be willing to meet within a couple hours drive (I am in Frederick, MD).

    I may consider some trades. Feel free to make reasonable offers.


    These are eating F/T rat pinks and are ready to go. All will come with signed documentation guaranteeing genetics, I will also provide feed/shed logs.


    Woma het Albino #3 1.0



    Woma het Albino #4 0.1 (This girl needs to eat a couple more time before she is ready to go)



    Woma het Albino #5 0.1



    Woma het Albino #6 1.0



    Woma het Albino #7 1.0




    I can provide additional pictures and weights upon request.

    Feel free to contact me with any questions you may have. I have limited access to the forums so it is best to email me at my username @gmail


    I also have 1.1 wild-type het Albino. $50 plus shipping for the male, $150 plus shipping for the female. Shipping will be actual cost. Or take the pair for $225 shipped. All the wild-types in this clutch were black back, do not know if it is genetic but may be... Pics available upon request.


    Thanks
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. #2
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    Bump

    New price

    Asking $800 for males, $900 for females plus shipping. I would prefer PayPal but will accept check or money order (animal held until payment clears). Shipping via SYR. I would also be willing to meet within a reasonable driving distance (I am in Frederick, MD).

    I may consider some trades. Feel free to make reasonable offers.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1