» Site Navigation
2 members and 607 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,909
Threads: 249,108
Posts: 2,572,139
Top Poster: JLC (31,651)
|
-
Re: Woma x Lesser
Platinum is Lesser X Daddy Gene. The Daddy gene is found in the Lesser and normal sibs produced by a Platinum X Normal pairing. Pairing a Lesser with Platinum in its lineage to a normal sibling with Platinum in its lineage may give you Platinum. Breeding a Platinum to a Lesser carrying the Daddy gene may also give you platinums, lessers, BELs, and normal carriers...it's complicated. 
All Lessers derive from the original Platinum "Platty Daddy", to the best of my knowledge.
That having been said, that is one seriously smokin' Lesser.
-
-
BPnet Veteran
-
-
Re: Woma x Lesser
 Originally Posted by WingedWolfPsion
Platinum is Lesser X Daddy Gene. The Daddy gene is found in the Lesser and normal sibs produced by a Platinum X Normal pairing. Pairing a Lesser with Platinum in its lineage to a normal sibling with Platinum in its lineage may give you Platinum. Breeding a Platinum to a Lesser carrying the Daddy gene may also give you platinums, lessers, BELs, and normal carriers...it's complicated. 
You over complicated it. 
The "Daddy"/"Hidden"/"sib" gene is just another allele in the BluEL complex. A Platty is basically a really dirty BluEL. It is a combo of Lesser and "Daddy"/"Hidden"/"sib" in the same manner that the MysticPotion is a really dirty BluEL combo of Mystic and Mojave.
A Platty bred to a normal gives you Lessers and what RDR calls "sibs". These "sibs" carry the "Daddy"/"Hidden"/"sib" gene, none of the Lessers carry the gene or they would be Platty. Breeding a "sib" back to any other het BluEL has the potential to give rise to a "Daddy"-type combination that is dependent on what the non-"sib" parent is. That is why RDR got ButterDaddy when he bred a Butter to a "sib" and Phantom44 (RDR's name for the Phantom/"Daddy" combo) when he bred a Phantom to a "sib". Neither the Butter parent nor the Phantom parent in those crosses had any relation to the PlattyDaddy so the "Daddy"/"Hidden"/"sib" allele came only from the "sib" parent.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
BPnet Veteran
Re: Woma x Lesser
thats one smoking lesser.. !.. cant wait to see the combination!
-
-
Re: Woma x Lesser
Love that lesser!!! Good luck
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|