Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 709

0 members and 709 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,905
Threads: 249,106
Posts: 2,572,115
Top Poster: JLC (31,651)
Welcome to our newest member, Pattyhud
Page 5 of 5 FirstFirst 12345
Results 41 to 43 of 43
  1. #41
    BPnet Senior Member jglass38's Avatar
    Join Date
    08-28-2004
    Location
    New Jersey
    Posts
    10,055
    Thanks
    215
    Thanked 509 Times in 244 Posts
    Images: 1

    Re: Some Woma's we produced

    Wow..Talk about confusing. Maybe it's time to rename the "Type II" morph? Even then, it likely wouldn't stop an unscrupulous breeder from selling them as "hidden gene". Welcome to the wonderful world of Ball Pythons where a lot isn't as it appears! Thanks to Matt and Sean for helping to clear this up! Beautiful animals Matt!

  2. #42
    BPnet Veteran
    Join Date
    06-22-2006
    Location
    Mississippi
    Posts
    1,334
    Thanks
    1,492
    Thanked 455 Times in 258 Posts
    Images: 6

    Re: Some Woma's we produced

    "The original Type I animal you need to think of as a 2 banger. It has the Type I gene AND carried the "hidden" gene. Now, when Kevin bred his founder animal the "hidden" gene would have 1 in 2 odds of being passed on. Additionally the Type I gene had a 1 in 2 chance of being passed on. So the odds of getting another Type I that also carried the "hidden" gene are 1 in 4. The important message to take home here is that not all Type I animals bred from the founder will necessarily have the "hidden" gene. And, by extension, any Type I subsequently produced from those offspring will not necessarily carry the "hidden" gene."

    The information that I have been given is that the Type 1 phenotype and the "hidden genne" are not produced separately. In other words, if you have the Type 1 phenotype, you have the "hidden gene".
    "Selective Breeding Begins With Selective Buying"

    Louis Kirkland
    Stealth Exotics on facebook
    Cornerstone Reptiles on facebook

  3. #43
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Some Woma's we produced

    Quote Originally Posted by Serpent_Nirvana View Post
    ... So then there should also, theoretically, be some normal BPs out there with the silent "hidden" gene that was originally carried by the Type I double-carrier, correct?
    Correct.

    Does that gene still have the same effect by itself, or is the Type I gene also necessary for the neat combos such as the soul-sucker?
    I am not sure I follow the first part of the question... But I will answer it the way I think you are asking it. The Type I gene causes a lot of interesting tricked out patterns when combined with other morphs. If you look at the NERD photo gallery, it was said that all the Woma combos on that page are Type I combos. The "hidden" gene however only really comes in to play when it combines with other alleles in the BluEL complex

    Is the soul-sucker a triple-combo (Type I x hidden gene x lesser), or just a double (hidden gene x lesser)?
    The SoulSucker is a triple combo of Type I/"hidden"/Lesser. It is easier for me to think of it as a Type I Platinum.

    Quote Originally Posted by Louis Kirkland View Post
    The information that I have been given is that the Type 1 phenotype and the "hidden genne" are not produced separately. In other words, if you have the Type 1 phenotype, you have the "hidden gene".
    Per my conversations with Matt and with Kevin this is not the case.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  4. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Serpent_Nirvana (08-10-2009),Ssthisto (09-08-2009)

Page 5 of 5 FirstFirst 12345

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1