» Site Navigation
0 members and 692 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,909
Threads: 249,113
Posts: 2,572,177
Top Poster: JLC (31,651)
|
-
Re: Super Spider Ball
 Originally Posted by Dave86
Why should an homozygous form be letal?
Because sometimes that's just how the genetics works.
http://en.wikipedia.org/wiki/Achondroplasia
This form of human dwarfism is homozygous-lethal, but presents itself as a mere physical change for anyone heterozygous for the dwarfism gene.
There are other snake morphs out there that are non-lethal for heterozygous snakes but lethal for homozygous snakes.
These include the pearl BP (at least so far to my knowledge), and super jaguar carpet python morph (they develop as leucistic carpet pythons, and form complete bodies, but die in the egg prior to hatching).
Interestingly the jag carpet python morph causes neuro issues, similar in some regards to the spinning and wobble you get with spider ball pythons. It does not surprise me at all that any gene that causes neuro issues for heterozygous snakes might cause even more serious brain issues leading to lethality in snakes that are homozygous for the gene.
-
-
Re: Super Spider Ball
 Originally Posted by Dave86
I know about that...I just don't know why people say a super spider MUST be lethal just because it's homozygous, without having or having had any proof like we have with womas, I hope you understand what I mean.
I do get what you are saying but it is like Turbo said, absence of a snake that dies in the egg or shortly after hatching is not evidence that the super form is not lethal.
Given the close similarities to the Jag morph (as noted by butter) I would not be at all surprised if the super Spider were lethal. I would also not be a all surprised to learn that some of the big breeders may already know the truth and are just not talking about it. After all, the wobble/spin in spiders is already a raging controversy with some people, toss a lethal super into that controversy and you may as well pour gasoline on a bonfire...
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Registered User
Re: Super Spider Ball
 Originally Posted by Turbo Serpent
Because there is no proof of one existing so it has been deducted that it must either a) die in the egg b)the egg dies during incubation c) the eggs containing the supers are laid as slugs.
I think noone pursuits this target...that's why we don't know about a super.
When the firts spiders hatchet their price was high...If you were a professional breeder what would you do? Selling them or raising all the babies and breed them to normal several times?
Maybe I would lol 
But I think that if spider x spider eggs died during incubation, we would know.
-
-
Registered User
Re: Super Spider Ball
I have a way to solve this WHOLE dilemma. Someone send me a yearling pair of spiders and I will raise them up and when the female is 2000+ grams I will breed them. I will then keep back all the offspring and raise them up and breed them to normals.  
Sure it will take a few years but I am willing to put in the work in order to get to the bottom of this. lol
-
-
BPnet Veteran
-
-
Registered User
Re: Super Spider Ball
 Originally Posted by HeartAche
I have a way to solve this WHOLE dilemma. Someone send me a yearling pair of spiders and I will raise them up and when the female is 2000+ grams I will breed them. I will then keep back all the offspring and raise them up and breed them to normals. 
Sure it will take a few years but I am willing to put in the work in order to get to the bottom of this. lol
It doesnt take a whole lot of work, all it is is just sacrificing the ability to create better combos, thats why you dont see the super spider stuff more often. I actually plan to eventually get 2 spiders and start the super spider stuff.
Nice try on getting some free spiders though lol
-
-
Registered User
Re: Super Spider Ball
I also plan to work on producing and proving it out
 xXxFluffyxXx 
Aim=ask me
Msn & Yahoo =ask me
1.0 100% Het Pied
0.1 50% Het Pied
0.3 Normals
0.0.3 Beardie
-
-
Re: Super Spider Ball
NERD bred spider to spider plenty when they got the spider BP originally. No super spider has been proven yet. Does this mean super spider is lethal? No, not proven. Does this mean there is no super? Not proven, but darned likely.
Check out that first link in LGL's post above. Unfortunately I had a heat incident this season, so I don't know if I have any clutches at all from Sam this year. The clutch in the incubator is a "who's your daddy" clutch, so I would guess it doesn't count.
I will be breeding Sam next year to a few normal females, exclusively bred to him. I feel that should help me prove or disprove whether he is a possible super spider. Right now, he's just a real darned lucky spider dad, although all the dead fetuses make me wary.
Theresa Baker
No Legs and More
Florida, USA
"Stop being a wimpy monkey,; bare some teeth, steal some food and fling poo with the alphas. "
-
-
Registered User
Re: Super Spider Ball
 Originally Posted by Dave86
Nobody owns a proof of that, I think it's just a myth.
Why should an homozygous form be letal?
Somebody here has got a spider which gave 100% spider when paired with a normal.
Has it been producing 100% spiders multiple times in a row without a normal in the clutch? If not, the chances aren't that low to have a fluke 100% spider clutch, especially depending on the size of the clutch if it was a ~4 egg clutch.
-
-
BPnet Veteran
Re: Super Spider Ball
If there ends up being a "Super" Spider, I would guess it would be one that has at least one other gene involved, ideally even more. There might be some combination that cancels out the lethality.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|