» Site Navigation
0 members and 2,365 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,050
Threads: 249,210
Posts: 2,572,718
Top Poster: JLC (31,651)
|
-
Registered User
-
-
Re: Some Woma's we produced
Nice! I loves me some Womas
-
-
Re: Some Woma's we produced
Aww I love womas! They don't get enough credit!
-
-
Re: Some Woma's we produced
Definately some good looking woma's
-
-
Registered User
Re: Some Woma's we produced
Deano
-
-
Re: Some Woma's we produced
Rick,
Very nice animals. From what I have seen, and what I believe, I think those are carriers. I also have a Woma from Sean, and believe it to be a carrying Woma. I have seen alot of Seans Womas, and believe he has the special ones. Good luck with the project. I will be doing some cool stuff with my male this year.
-
-
Registered User
Re: Some Woma's we produced
Rick,
Very nice animals. From what I have seen, and what I believe, I think those are carriers. I also have a Woma from Sean, and believe it to be a carrying Woma. I have seen alot of Seans Womas, and believe he has the special ones. Good luck with the project. I will be doing some cool stuff with my male this year.
Thanks Tim, I was thinking they might be because they look different from the female I have that I purchased from someone else. I just regret not buying the adult female woma that Sean had available when I bought the male. I think Amir grabbed it before I had the chance. I'm going to try to see if Brian Potter will send the pics to Kevin to have him take a look and see what he says.
I ended up with 2.2 of them and don't want to sell them if they are the carriers.
-
-
Re: Some Woma's we produced
 Originally Posted by muddoc
From what I have seen, and what I believe, I think those are carriers. I also have a Woma from Sean, and believe it to be a carrying Woma. I have seen alot of Seans Womas, and believe he has the special ones.
 Originally Posted by rjs73
Thanks Tim, I was thinking they might be because they look different from the female I have that I purchased from someone else.... I ended up with 2.2 of them and don't want to sell them if they are the carriers.
It is not really a matter of them being carriers that give them the "different" look. The "Hidden Gene" Woma and the "typical" Woma are, in all likelyhood, two different morphs. Kevin imported two animals on separate occasions that looked similar and he assumed were the same, only later did he figure out they were actually different. The first one he acquired was the one everyone calls a "Hidden Gene" woma and this is sort of a misnomer. The original founder animal did indeed carry a hidden gene, that is why it made SoulSuckers when bred to a Lesser. However, not all offspring from that founding animal would have gotten the "hidden gene" (only 50% chance of passing it on). And, subsequently, any offspring from those offspring would not necessarily have the "hidden gene" and so on and so on and so on...
The "Hidden Gene" womas have a different look from a "typical" woma but that has nothing to do with the presence or absence of the actual "hidden gene", it is because they are different morph (or at the very least different alleles)
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: Some Woma's we produced
Hi,
So can someone tell me how to tell if a woma is the hidden gene variant? 
dr del
Derek
7 adult Royals (2.5), 1.0 COS Pastel, 1.0 Enchi, 1.1 Lesser platty Royal python, 1.1 Black pastel Royal python, 0.1 Blue eyed leucistic ( Super lesser), 0.1 Piebald Royal python, 1.0 Sinaloan milk snake 1.0 crested gecko and 1 bad case of ETS. no wife, no surprise.
-
-
-
The Following User Says Thank You to The Cleaner For This Useful Post:
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|