Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,529

0 members and 1,529 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,937
Threads: 249,130
Posts: 2,572,295
Top Poster: JLC (31,651)
Welcome to our newest member, GeorgiaD182
Page 5 of 7 FirstFirst 1234567 LastLast
Results 41 to 50 of 61
  1. #41
    BPnet Senior Member Denial's Avatar
    Join Date
    03-21-2009
    Location
    Greenville, SC
    Posts
    2,553
    Thanks
    775
    Thanked 657 Times in 327 Posts

    Re: Repticon Atlanta 09, huge any computer warning :p

    I enjoyed the show. Although I was at sam and theresas table pretty much the whole time holding and drooling all over the hypo het lucy burms. I have to have one of those snakes. They are just mindblowing in person. I saw alot of low prices at the show not just balls but with other species to.

  2. #42
    BPnet Veteran CoolioTiffany's Avatar
    Join Date
    06-26-2009
    Location
    Arizona
    Posts
    4,482
    Thanks
    2,173
    Thanked 765 Times in 649 Posts
    Images: 11

    Re: Repticon Atlanta 09, huge any computer warning :p

    Picture #48- I wish my Dumeril's gets that big really soon!! It looks so beast, don't you just love em'?
    Picture #50- I have that spray bottle.. I got it at the dollar store!
    Tiff'z Morphz

  3. #43
    Registered User ChristinaP's Avatar
    Join Date
    03-15-2009
    Posts
    255
    Thanks
    28
    Thanked 22 Times in 22 Posts
    Images: 1

    Re: Repticon Atlanta 09, huge any computer warning :p

    niiiiiiiiice
    Jake the Snake Normal Ball Python
    Ira Albino Corn Snake
    Zeke Anerythristic Corn Snake

  4. #44
    Registered User
    Join Date
    08-25-2008
    Posts
    9
    Thanks
    0
    Thanked 1 Time in 1 Post

    Re: Repticon Atlanta 09, huge any computer warning :p

    Quote Originally Posted by twistedtails View Post
    Is this the reseller you guys are talking about??
    That's what I took it as. I wasn't there to see it. Everyone else was beating around the bush about it, Neil stepped up. I will seek him out for my next purchase because of that.

  5. The Following User Says Thank You to BryGuy For This Useful Post:

    neilgolli (08-05-2009)

  6. #45
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Repticon Atlanta 09, huge any computer warning :p

    Guys, I hate to sound like an idiot on this but without facts to back yourselves up you are just tossing out baseless information.

    I am not in any way defending his prices, they were stupid low. But while I was taking pics of some of his animals I over heard him on a couple sales and he guaranteed the animals to be feeding. Even gave the customers his card and underlined the email and phone and said to not hesitate to contact him if there were problems.

    Also, I just ran him on the BOI real quick and he does not have any bad guy threads there.

    So yeah, maybe he is flipping some stuff he got wholesale but beyond that you cannot reasonably speculate.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  7. #46
    BPnet Veteran twistedtails's Avatar
    Join Date
    05-11-2009
    Location
    Southern California
    Posts
    1,927
    Thanks
    369
    Thanked 455 Times in 358 Posts

    Re: Repticon Atlanta 09, huge any computer warning :p

    Quote Originally Posted by asplundii View Post
    Guys, I hate to sound like an idiot on this but without facts to back yourselves up you are just tossing out baseless information.

    I am not in any way defending his prices, they were stupid low. But while I was taking pics of some of his animals I over heard him on a couple sales and he guaranteed the animals to be feeding. Even gave the customers his card and underlined the email and phone and said to not hesitate to contact him if there were problems.

    Also, I just ran him on the BOI real quick and he does not have any bad guy threads there.

    So yeah, maybe he is flipping some stuff he got wholesale but beyond that you cannot reasonably speculate.

    I can agree that good prices for great snakes is not unheard of. I picked up a pair of het pieds at the show by my house for $200. The seller just has bigger and better things to work with other than hets. He is big into the double recessives. The female is a bit picky on eating but the male has put on over 100 grams in a month and a half. To tell you the truth, had I been at that show, I would have probably bought them granted they looked healthy in person.

  8. #47
    Telling it like it is! Stewart_Reptiles's Avatar
    Join Date
    09-28-2006
    Posts
    24,845
    Thanks
    6,116
    Thanked 20,812 Times in 9,584 Posts
    Blog Entries
    1
    Images: 6

    Re: Repticon Atlanta 09, huge any computer warning :p

    he guaranteed the animals to be feeding.
    When an animal did not even have it's first shed (and there were several of them) this is not an animal that is feeding or that can be guarenteed to be feeding, and I strongly believe that NO ANIMAL should be sold before their first shed and had several meals in them.

    So yeah, maybe he is flipping some stuff he got wholesale but beyond that you cannot reasonably speculate.
    The animal not eating is in no way speculation it is a fact see above.
    Deborah Stewart


  9. #48
    BPnet Veteran
    Join Date
    08-18-2008
    Posts
    2,754
    Thanks
    710
    Thanked 737 Times in 457 Posts

    Re: Repticon Atlanta 09, huge any computer warning :p

    Quote Originally Posted by BryGuy View Post
    That's what I took it as. I wasn't there to see it. Everyone else was beating around the bush about it, Neil stepped up. I will seek him out for my next purchase because of that.
    I wasn't beating the bush I simply didn't know.

  10. #49
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Repticon Atlanta 09, huge any computer warning :p

    Quote Originally Posted by Deborah View Post
    When an animal did not even have it's first shed (and there were several of them) this is not an animal that is feeding or that can be guarenteed to be feeding, and I strongly believe that NO ANIMAL should be sold before their first shed and had several meals in them.

    The animal not eating is in no way speculation it is a fact see above.
    Deborah,

    If the bone you have to pick with him is that he was selling animals that had not had their first shed then I think you need to add at least 7 other vendors (that I distinctly remember) to that list. And those other vendors were selling at more "typical" prices... Maybe that is why no one has bothered mentioning their executing that same gross violation

    And again I ask, how can you guarantee that all those animals he was selling had not had their first shed? Did you ask him specifically? Cause if you did not then, yeah, it is speculation. You are speculating that they had not had their first shed and therefore you are speculating that they are not eating.


    Again, I am not defending his prices. But if that is the problem you have with him then just stick to that and quit making things up to add to the "crime". He is a flipper is reason enough for people to not like it. Do we really need to tack on baseless accusations of "they are not eating" or "they have not yet shed" to justify not liking it? What is next, is someone going to accuse him of having IBD animals? Give me a break.

    He had ridiculously low prices cause he was flipping. No further "justification" is needed. That people are stretching to come up with further justification, to me, makes it sound like sour grapes more than anything else.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  11. #50
    BPnet Veteran Haydenphoto's Avatar
    Join Date
    06-07-2009
    Location
    Chicagoland
    Posts
    392
    Thanks
    48
    Thanked 45 Times in 40 Posts
    Images: 4

    Re: Repticon Atlanta 09, huge any computer warning :p

    Quote Originally Posted by FIREball View Post
    Who was selling Lessers for $250 and Albinos for $350
    LOL i was going to say the same thing . Looks like the prices are still dropping.

Page 5 of 7 FirstFirst 1234567 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1