Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,344

1 members and 1,343 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,937
Threads: 249,129
Posts: 2,572,289
Top Poster: JLC (31,651)
Welcome to our newest member, GeorgiaD182
Results 1 to 10 of 73

Threaded View

  1. #23
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: I Attended the HR2811 Hearing on July 29th

    Quote Originally Posted by Skiploder View Post
    Congratulations. You have just continued an argument that does nothing for this community.
    I fail to see how a divisive element within the community who obviously does not have all the facts has nothing to do with the community. If people in the community can make the same arguments as HSUS how does that have nothing to do to the community??

    Also, it is all well and good you pointing your finger at me but I hope you realize that by doing that you are sitting right here with me continuing this "worthless" argument...

    Have you checked your state government site to see what bills may be coming down the pipe that will affect your hobby? Don't rely on the USARK and PIJAC websites, in some cases they have been several months out in warning people about upcoming legislation.......
    As best I can, yes. Though it is not a daily thing for me. AS it is, so much is prohibited here it is not hard to keep up with...

    Enjoy your point-by-point debate with Dutchherp.
    This is my style of replying, it is how I think straight. If you search the forum for my posts you will see that I do it for debate or discussion or whatever. It is just my style, I do not care whether or not you like it.

    In the meantime, a sensationalist media, a gullible public, a reactionary political system and well-organized and funded machines like PETA and HSUS are nibbling away at your rights.
    You will get no argument from me on that

    Let me give you all a pointer here: they don't care about facts. You can e-pontificate until your fingers fall off and counter every point they make..........people outside this hobby (in general) don't care - it doesn't affect them and they don't like reptiles.
    It is not their ignorance of facts that bothers me. It is people within this hobby, like Dutch, who are willfully ignorant that bother me. There are valid, peer reviewed scientific articles that refute a number of his points and he willfully turns a blind eye to them.

    As large as this hobby may seem, we are still on the fringe
    Something I already knew

    Joe Sixpack and his Suburban driving ex-prom queen wife don't care to be educated on the potential migratory routes of pythons in Florida and they sure as heck don't care about whether all those man-eating burms were released on purpose or on accident.
    Having done more than a few reptile presentations for schools I disagree to an extent. If you can pique the interest of Joe Sixpack and his wife then often times you can get them to listen and they really are interested in what you have to say. The problem is that for every one family you can reach that way there are 5000000000 more being reached by the media hype. The war of attrition...

    At what point does the fact that USARK and PIJAC are now passing legislation and working on amendments to these bills clue you in to the fact that these laws are something that can't be argued away?
    You presume to know me. Never once have I said these bills are going to be argued away. I have felt and still feel that we have been playing a game of catch up for too damn long.

    While USARK did an admirable job in writing law in NC, the provisions for enforcement that they helped pen should worry everyone here. How many of you have given USARK and PIJAC feedback about the work they are doing?
    Well I for one have emailed USARK with suggestions and recommendations numerous times. Both positive and negative feedback.

    Don't you think addressing those things, or better yet educating yourself on these points, helps the cause more than debating each other point by point?
    Yeah, addressing those matters is important. However I do not think someone within the community, who has an obvious lack of understanding on the matter, spreading derisiveness is doing us one bloody bit of good either. HSUS, PETA, and the like probably love seeing us at each others throat, it makes their job so much easier.

    Let me clue some people in here - there are quite a few of us that have seen this coming for awhile. This hobby has arrogantly assumed that we could keep whatever we want, anyway we want and in general, act irresponsibly with no consequences. Well, the bill is now coming due. USARK and PIJAC are having to deal with steaming pile of crap that WE made. Some of the most vocal supporters of USARK and PIJAC are the same arrogant jerks who indiscriminately sold giants and hots to people who had no business owning them......it makes me sick.
    Well I am sick to death of all these people who talk about how they saw this coming and use every opportunity to say that. Great, you saw it coming... What the heck were you doing about it back then other than seeing it coming? A Cassandra Complex does not do us any good. So you saw it coming. And yet you did nothing about it back when you saw it coming. You are just as guilty for this mess we are in as the rest of us so take that finger you are pointing at us and turn it right back on yourself.

    I am not gong to waste my time trying to educate a deaf public to the fact that my thelatornis or rhabdophis pose no threat to the them.
    That is your choice. I still find that, on an individual level the public can be educated and turned to our side. However, when I see someone within the community being willfully ignorant I will step up. Like I said above, divisiveness within is more destructive than pressure from without.

    We all have differing opinions on what should be done, but the reality is that the focus is now on dealing with, heading off and amending legislation.
    Actually, I think that amending legislation is just continuing to play the catch up game. We, as a community need to start making the legislation. We have to start regulating ourselves because that is the surest way to keep others from deciding to step in and regulate us.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    Muze (07-31-2009)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1