» Site Navigation
0 members and 556 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,916
Threads: 249,118
Posts: 2,572,199
Top Poster: JLC (31,651)
|
-
Re: Are morphs endless??
 Originally Posted by asplundii
I do not mind if you disagree, makes for good debate
Your refutation of my post only supports what I have said. The genome of the ball python is limited. That is a fact. There are only a very specific number of bases in that genome. IDK what that exact number is, not sure anyone has actually gone about finding that information out. But for arguments sake, let us say it is 2 gigabases. Only so many of those bases can be mutated to bring about a definite phenotype. That gives you a limiting number. And when you have a defined, limiting number it is not possible to reach "infinity" with it. Eventually you come to the end.
Your note on eye colour is correct (it is polygenetic) but in this case it does not so much apply because you are talking there about a situation that is less about morphs and more about population variability. After all, every normal ball python is a normal ball python even if their patterns are slightly different from one another.
I loves me a good civil debate 
I was saying that color is finite, other things such as pattern are infinite. Each snake is its own special snowflake. I dont think i know enough about BP genome to really go on though :\
Where can i learn more?
-
-
Re: Are morphs endless??
 Originally Posted by cinderbird
I was saying that color is finite, other things such as pattern are infinite.
I can accept that, to an extent. I more look at it that subtleties in pattern are "infinite". However gross pattern differences (i.e. pin, spider, woma, clown) are finite.
Each snake is its own special snowflake.
Absolutely. However, each snake, on being a snowflake, is not a morph.
And that is what I was getting at. While there will always be "infinite" variability between snakes, the actual number of base morphs possible (albino, spider, pastel, hypo, etc) are absolutely finite.
I dont think i know enough about BP genome to really go on though :\
Where can i learn more?
Depends on the detail level you want. A more advanced genetics course might cover some levels of what you are looking for in as much as ball pythons are subject to the same genetic rules other eukaryotes are.
But if you want ball python genetics specifically there is nothing. The BP genome has not been sequenced to any extent that I know of. Wish I had the time and funds to change that but right now my projects are in a decidedly different field.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|