» Site Navigation
1 members and 656 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,070
Threads: 249,220
Posts: 2,572,801
Top Poster: JLC (31,651)
Welcome to our newest member, mh789
|
-
BPnet Veteran
Re: Are morphs endless??
 Originally Posted by I<3Dreamsicles
No a box with lights isnt worth several thousand dollars. BUT thoes boxes decrease in value as they become less common. Im saying morphs should too.
I am confused? So the more rare an item the less its worth? I think you meant they decrease in value as they become more common. Which is true of everything.
-
-
Registered User
Re: Are morphs endless??
With the way nature is, the bp natural morphs coming out of africa will probebly never end. things are always in motion, wether it takes a day or a hundred years things have to change and evolve. I no people that will pay millions for things that may be pointless to you and me, but from there point of view its worth it. Then again when you can spend a million on a painting then you def. have no wry's about money, and can blow it anyway they want. (wish I could do that)
-
-
BPnet Veteran
Re: Are morphs endless??
 Originally Posted by CoolioTiffany
Snakes in the wild and snakes bred in captivity will probably always be making new morphs. I think it wouldn't stop since many breeders are trying to come up with more and more different morphs each year. Some of the extraordinary morphs produced in captivity are banana clowns and panda pieds. Panda pieds are worth.. maybe 20k at the most (that's what I was told..)? And banana clowns are worth a good 40k. Just image how many more morphs will be created and how much the value of that morph will be. One day, I know there will be some amazing morph costing AT LEAST 100k.
$100k has been topped for a bp a long time ago. ive heard prices up as far as 250k
"So far this is the oldest that I've been"
'If you can make it through the nite, there's a brighter day'
"I'm out the game, put the 2nd string in."
"live with the pain and keep trying or die knowing you never gave anything a chance"
"Death is not the greatest loss in life. The greatest loss is what dies inside while still alive"
"No one can take away your dreams"

People for the Ethical Treatment of Agriculture
-
-
BPnet Veteran
Re: Are morphs endless??
When thinking about cost of a new morph, one needs to think about the years it took to get to that stage, the expensive morphs are ones not common in numbers and ones that took a breeder years to get to the point where they could have adult bp's with the genetics they have bred to be ready to produce offspring.
If a clown which has het animals available can go for 1500 and above then it is not hard to see how animals can creep up the scale when you think about the years of getting one genetic animal and then raising that animal up, successfully breeding it, hitting the odds, no failure in incubation etc etc...when you get up into bp's that have several dominant or several recessive qualities it can take an eternity to get that animals to come out of an egg.
-
-
Re: Are morphs endless??
Well I am going to buck what everyone is saying and give a totally different answer.
There will most definitely be an end to wild base morphs at some point.
Granted, nature is prone to making little mistakes in the DNA from time to time but not every single one of those mistakes will result in a morph. Just because a gene can be changed does not mean that it will absolutely change the phenotype. In fact, most mutations on the DNA level are silent.
Additionally, there are some genes that are essential. That is, they cannot be mutated because if they are the animal dies. Period.
So, when you consider silent mutations and essential genes, you get a limed number of locations that can be mutated to bring about a phenotype. And any time there is a limited number it will eventually be tapped out.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
-
BPnet Veteran
Re: Are morphs endless??
Nothing can stop it, other than the number of possibilities to modify the number of gene possible.
But all of them are not a phenotype either (some can't be seen). While others cause death and other weird stuff.
Well, if you do all the mutation you can on an ADN you will get another animal. Isn't it the way the life evolved ?
Otherwise, I would believe we are near the end. If it fallow the market and management idea.
AT the start, only a few new innovation comes up (albino, piedbald were the first, with may be the ghost).
Then the increase in innovation (spider, pinstripe, mojave, lesser, etc...), we see more and more to appear.
Then it's a sort of stability, we only see a few innovation coming in (banana, mystic, yb, etc...)
Then it's the decrease, there is nearly no new innovation.
I would believe we are in the stability part. In the wild, people are trying to find new stuff since they can make lot of money if they do, but they nearly don't find any more.
If we had the combos to it. I would say we still have lot of time before we see a decrease and less interest from the people. Like it happenned with the corns.
But the snake stuff, is a bit different than anything else. Do you know any other product that can produce other product like himself ?
What would the world be if you could buy a dishwasher and reproduce another dishwasher a few years later and sell it ?
-
-
Re: Are morphs endless??
 Originally Posted by asplundii
Well I am going to buck what everyone is saying and give a totally different answer.
There will most definitely be an end to wild base morphs at some point.
Granted, nature is prone to making little mistakes in the DNA from time to time but not every single one of those mistakes will result in a morph. Just because a gene can be changed does not mean that it will absolutely change the phenotype. In fact, most mutations on the DNA level are silent.
Additionally, there are some genes that are essential. That is, they cannot be mutated because if they are the animal dies. Period.
So, when you consider silent mutations and essential genes, you get a limed number of locations that can be mutated to bring about a phenotype. And any time there is a limited number it will eventually be tapped out.
I understand what you're saying and how it makes sense but i respectfully disagree i feel that with the genome of the BP as it is now, there are an infinite number of possibilitiles. TRUE most mutations are detrimental or non compatible with life, but we do end up seeing many. New morphs pop up all the time. Sure color/pattern variations (what we refer to as morphs) can be connected to other issues (such as in spiders). I feel that it is possible that we may see an increase in color/pattern variations being connected with other "things", (example: in humans, eyecolor is connected to at LEAST 3 genes, i have no idea of the locii or the number of genes but i know it is at least 3). So maybe color could also be connected to...scale counts or head size, or maybe a snake could end up with 13 kidneys or something and we'd never know all because its "blurple".
given what we know, there is a finite number of possibilities in the colors alone that we see because the pigmentation itself has limits (ie we have yet to see blue hued ball pythons because they lack blue pigmentation). Is it possible the pigment could change and we could see blue BPs? I can't say no with 100% certainty.
-
-
-
-
Re: Are morphs endless??
 Originally Posted by cinderbird
I understand what you're saying and how it makes sense but i respectfully disagree  i feel that with the genome of the BP as it is now, there are an infinite number of possibilitiles.
I do not mind if you disagree, makes for good debate 
Your refutation of my post only supports what I have said. The genome of the ball python is limited. That is a fact. There are only a very specific number of bases in that genome. IDK what that exact number is, not sure anyone has actually gone about finding that information out. But for arguments sake, let us say it is 2 gigabases. Only so many of those bases can be mutated to bring about a definite phenotype. That gives you a limiting number. And when you have a defined, limiting number it is not possible to reach "infinity" with it. Eventually you come to the end.
Your note on eye colour is correct (it is polygenetic) but in this case it does not so much apply because you are talking there about a situation that is less about morphs and more about population variability. After all, every normal ball python is a normal ball python even if their patterns are slightly different from one another.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: Are morphs endless??
 Originally Posted by asplundii
I do not mind if you disagree, makes for good debate
Your refutation of my post only supports what I have said. The genome of the ball python is limited. That is a fact. There are only a very specific number of bases in that genome. IDK what that exact number is, not sure anyone has actually gone about finding that information out. But for arguments sake, let us say it is 2 gigabases. Only so many of those bases can be mutated to bring about a definite phenotype. That gives you a limiting number. And when you have a defined, limiting number it is not possible to reach "infinity" with it. Eventually you come to the end.
Your note on eye colour is correct (it is polygenetic) but in this case it does not so much apply because you are talking there about a situation that is less about morphs and more about population variability. After all, every normal ball python is a normal ball python even if their patterns are slightly different from one another.
I loves me a good civil debate 
I was saying that color is finite, other things such as pattern are infinite. Each snake is its own special snowflake. I dont think i know enough about BP genome to really go on though :\
Where can i learn more?
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|