» Site Navigation
1 members and 1,948 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,917
Threads: 249,118
Posts: 2,572,209
Top Poster: JLC (31,651)
Welcome to our newest member, Necbov
|
-
Re: Albino Super Cinny... anybody want to take a guess?
 Originally Posted by Pulcher
I heard someone (i think VPI not sure) is going to try to make an all purple snake. I heard it was going to be a super cinnamon lavander albino which theoretically would be a purple snake.
that was BHB
-
-
Re: Albino Super Cinny... anybody want to take a guess?
 Originally Posted by Mike Cavanaugh
You may be right... but I HOPE you are wrong...
The albino super black pastel has been made and since cinny and black pastel are alleles...
 Originally Posted by Mike Cavanaugh
Has anybody made an albino Lucy yet?
 Originally Posted by RegiusCo
Yes and pics have been posted on this very forum. 
Search "Polar Ball". It is an albino VinRusso lucie
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: Albino Super Cinny... anybody want to take a guess?
My theory is that the albino super cinny will come out looking all white, but over time as it matures, it'll start to yellow up.
A guarantee though (I think) would be an albino Silver bullet. The albino pewter came out looking yellow in the areas where its usually pewtered colored, so if you figure an albino Silver bullet should be all yellow as well. Just my though.
-
-
Re: Albino Super Cinny... anybody want to take a guess?
I think the best "easiest" to get solid orange ball will be an albino champagne. Following that would be the albino patternless.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: Albino Super Cinny... anybody want to take a guess?
Welcome to a month ago. 
BUT...it's a super black pastel, not cinnamon.
http://www.ball-pythons.net/forums/s...ad.php?t=94113
____JOSHUA____
___  ___
ROCK CHALK JAYHAWK GO KU!!
Kansas City Chiefs
-
-
BPnet Veteran
Re: Albino Super Cinny... anybody want to take a guess?
 Originally Posted by Pulcher
I heard someone (i think VPI not sure) is going to try to make an all purple snake. I heard it was going to be a super cinnamon lavander albino which theoretically would be a purple snake.
That was Brian from Snakebytes and BHB Reptiles. He hopes to make an all lavender snake by breeding a lav albino to a super cinny. He thinks it will be purple because regular albinos turn the black of a normal to white and lavender albino makes the white of regular albinos turn purple, and since a super cinny ball is an almost all black or dark brown snake, the lavender albino gene will turn all that dark color into purple.I am really looking forward to see that!
Guitars, Reptiles, & Fishing!
1.3.1 Crested Geckos
1.0.0 Nu Ana x Moro Leachianus Gecko
1.0.0 Jungle Carpet Python
1.0.0 Normal Ball Python
1.0.0 Bearded Dragon
& Lots of terrified-snake relatives!
-
-
Registered User
Re: Albino Super Cinny... anybody want to take a guess?
 Originally Posted by guambomb832
That was Brian from Snakebytes and BHB Reptiles. He hopes to make an all lavender snake by breeding a lav albino to a super cinny. He thinks it will be purple because regular albinos turn the black of a normal to white and lavender albino makes the white of regular albinos turn purple, and since a super cinny ball is an almost all black or dark brown snake, the lavender albino gene will turn all that dark color into purple.I am really looking forward to see that!
Thank you for clearing that up. I am very excited to see how that turns out. The first all purple ball python.
-
-
Re: Albino Super Cinny... anybody want to take a guess?
 Originally Posted by Jerhart
don't be so quick to assume that an albino super cinny will look the same. Of course I still honestly believe that the cinny and black pastel are two totally different morphs....
Mikey Cavanaugh
(904) 318-3333
-
-
BPnet Veteran
Re: Albino Super Cinny... anybody want to take a guess?
supercinny albino has been done with boas just under a different name it was a white snake
Reptiles make life tolerable.
Jeremiah Elleman[FONT="Comic Sans MS"][/FO
-
-
Re: Albino Super Cinny... anybody want to take a guess?
 Originally Posted by jere000
supercinny albino has been done with boas just under a different name it was a white snake
Done with boas?!?!?
Super Cinny Boa???!
You smoking dope?
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|