Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,311

0 members and 1,311 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,937
Threads: 249,130
Posts: 2,572,295
Top Poster: JLC (31,651)
Welcome to our newest member, GeorgiaD182
Results 1 to 10 of 47

Threaded View

  1. #11
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: CBS News and my egg cam

    I am going to be a stick in the mud just cause I am the paranoid type.

    I would first require that I know what story they plan to use it for before I would grant permission.

    I can just see them using the pics of the eggs to slander us on the whole captive breeding front: "See here how a hobby breeder flagrantly publicizes eggs he is incubating from python like the one that killed that poor child in FL..."

    Remember, they are news agents, it is their job to lie through their teeth to get the story.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    littleindiangirl (07-27-2009)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1