» Site Navigation
3 members and 1,776 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,050
Threads: 249,210
Posts: 2,572,716
Top Poster: JLC (31,651)
|
-
Different Womas
I've recently heard that NERD is considering its line of Womas to be possibly genetically different from typical Womas from different sources.
NERD has determined that Pearl, (Homozygous woma) is lethal. Does anyone know of people have bred Womas from other bloodlines together to produce pearls? I'm curious to know if both lines of Womas are homozygous-lethal.
-
-
Re: Different Womas
it would be VERY interesting to see a breeding from hidden line womas to "regular" womas
-
-
BPnet Veteran
Re: Different Womas
I don't think he said his woma were different line, but they were carring another gene.
Well, I don't know if he proved that gene could be isolated from the woma or not. But that's what I tought.
I would also like to know about more about the Pearl being lethal. I don't know how many breeders actually produced Pearl. I think a lot, just put their female woma to other project instead thinking it wasn't worth the try.
Woma are not as commun as spiders or some other gene. But I believe we should see more cross with it in the next few years. And may be more will try it with the Pearl. Just hope people let us know about it.
-
-
Re: Different Womas
In another forum the nature of NERD's hidden gene Womas was discussed in some detail. In that thread it was said by someone I trust that NERD brought in 2 different animals that looked similar and were initially considered the same but which Kevin now believes are different. I am still on the fence as to whether the Type I and Type II (for lack of better terms) are genetically distinct or simply alleles of the same gene. At this point there is not enough info, though I have asked if Kevin did a Type I x Type II breeding and was told that question would be relayed to Kevin.
The Pearl is the super form of the Type I and is indeed lethal. It is unknown if Kevin tried to produce a super form of the Type II and I think that might be a worth while progect as well.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|