» Site Navigation
2 members and 616 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,912
Threads: 249,118
Posts: 2,572,195
Top Poster: JLC (31,651)
Welcome to our newest member, coda
|
-
BPnet Veteran
woma x lesser
Do all woma lessers look this good?? Love the stripe.
http://www.newenglandreptile.com/ner...ll-python.html
Anybody have one?
-
-
Re: woma x lesser
Sadly, no. That's a woma x lesser made with the NERD "hidden gene" womas. Turns out some NERD line womas have an addition ("hidden") gene that only expresses when crossed with a lesser (and manifests as that crazy animal, sometimes known as a "soul sucker.") (Or perhaps NERD has a different line of woma altogether -- as far as I know, that isn't entirely clear, though others may know more about that than I do.)
For pictures of "normal" woma x lessers, see this thread here:
http://ball-pythons.net/forums/showthread.php?t=96780
-
-
BPnet Veteran
Re: woma x lesser
 Originally Posted by Serpent_Nirvana
Sadly, no. That's a woma x lesser made with the NERD "hidden gene" womas. Turns out some NERD line womas have an addition ("hidden") gene that only expresses when crossed with a lesser (and manifests as that crazy animal, sometimes known as a "soul sucker.") (Or perhaps NERD has a different line of woma altogether -- as far as I know, that isn't entirely clear, though others may know more about that than I do.)
For pictures of "normal" woma x lessers, see this thread here:
http://ball-pythons.net/forums/showthread.php?t=96780
Oh! I misunderstood and thought all womas had the hidden gene. Too bad!
-
-
BPnet Veteran
Re: woma x lesser
Like snakelady said, unfortunately not.
You can also look at BHB videos. Don,t remember wich ones, but we see a woma lesser in it. And it's georgeous Not the most special one, but quite nice. There is one as a baby, and the other time we see it is when he show the breeding for 09. So I wonder what he gonna get
-
-
Re: woma x lesser
 Originally Posted by Serpent_Nirvana
Sadly, no. That's a woma x lesser made with the NERD "hidden gene" womas. Turns out some NERD line womas have an addition ("hidden") gene that only expresses when crossed with a lesser (and manifests as that crazy animal, sometimes known as a "soul sucker.") (Or perhaps NERD has a different line of woma altogether -- as far as I know, that isn't entirely clear, though others may know more about that than I do.)
For a bit more detailed discussion on this matter check out this thread:
http://www.reptileradio.net/reptiler...ead.php?t=9389
Long and short of it though is that there are 2 different lineages of animals that we call woma that may or may not be genetically related. One of those lineages had a hidden gene in the founder animal (which, when bred to a lesser, gave rise to the SoulSucker) but not all the descendants from that founder animal will have the hidden gene.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|