» Site Navigation
0 members and 711 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,915
Threads: 249,118
Posts: 2,572,196
Top Poster: JLC (31,651)
|
-
BPnet Veteran
Re: Woma - Lesser Picture ? (No hidden gene)
-
The Following User Says Thank You to ItsMichael805 For This Useful Post:
-
Re: Woma - Lesser Picture ? (No hidden gene)
Hey Louis,
Thanks for the background... I am still not seeing it but maybe it is just the pics ???
Is dad a Lesser/Pastel?
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: Woma - Lesser Picture ? (No hidden gene)
 Originally Posted by asplundii
Hey Louis,
Thanks for the background... I am still not seeing it but maybe it is just the pics ???
Is dad a Lesser/Pastel?
Hopefully he will start earning his keep this fall and we can prove him out, although I have no doubt that he is a Woma Lesser.
I was told by Debbie that dad is a Pastel Lesser.
-
-
BPnet Veteran
Re: Woma - Lesser Picture ? (No hidden gene)
The name of the picture says Pastel Lesser for the dad !
Well, good luck on it 
I will consider this cross next year may.
-
-
Re: Woma - Lesser Picture ? (No hidden gene)
 Originally Posted by Watever
The name of the picture says Pastel Lesser for the dad !
Yeah well... I did not feel like checking that LOL cause my experience is that pics are usually labeled things like PQC3_110904_4 or something like that.
@ Louis,
I am not saying he is not Just saying that from the pic I do not see it, probably just cause of the nature of the pic, like you said. Could also be that it is a stand alone pic and if he were side by side with a regular Lesser I would see the difference. Still and all it is a great looking animal
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: Woma - Lesser Picture ? (No hidden gene)
That's not a woma-lesser. Woma-lessers have a light dorsal stripe, they look nothing like Womas, and only a bit like lessers.
That appears to be a lesser, or a pastel-lesser.
This is a woma-lesser: http://www.newenglandreptile.com/ner...s.womless1.jpg
As you can see, there's no mistaking it.
I'm sure it was a lesser from a womaXlesser clutch--I just produced one of those myself--but it's not a carrier of the woma gene.
-
-
BPnet Veteran
Re: Woma - Lesser Picture ? (No hidden gene)
 Originally Posted by WingedWolfPsion
On another forum, someone from NERD told me that this pictures is a Woma-Lesser + Hidden Gene.
Do you have a picture of the one you just hatched ? May be he have the hidden-gene ???
-
-
Re: Woma - Lesser Picture ? (No hidden gene)
 Originally Posted by WingedWolfPsion
That's not a woma-lesser. Woma-lessers have a light dorsal stripe, they look nothing like Womas, and only a bit like lessers.
Only from the hidden gene womas crossed with lessers.
-
-
Re: Woma - Lesser Picture ? (No hidden gene)
Hmm...you may be right. This one from Daytona is labeled as being a woma-lesser:
http://www.ballpythonmorphs.com/daytona06/bhb20.jpg
You can see the woma striping in its pattern.
This is my hatchling, clearly just a lesser:
http://eclipseexotics.wingedwolfpsio...LessMale-2.jpg
NERD should label its photos more specifically, lol.
-
-
BPnet Veteran
Re: Woma - Lesser Picture ? (No hidden gene)
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|