» Site Navigation
1 members and 2,510 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,050
Threads: 249,210
Posts: 2,572,718
Top Poster: JLC (31,651)
|
-
BPnet Veteran
Woma - Lesser Picture ? (No hidden gene)
Does any one have a picture of a normal woma-lesser ?
Not the ones NERD produced with the hidden-gene but the ones without it.
Does it look like a lesser bee ? Or it's a bit different ?
Thank you 
And does anyone have any idea if the lesser pearl NERD hatched in 2006 survived ? Cause we never heard of, so I would assume not, but well we never know, since he keep stuff secret 
Thank you guys (and girls)
-
-
Re: Woma - Lesser Picture ? (No hidden gene)
 Originally Posted by Watever
Does any one have a picture of a normal woma-lesser ?
Not the ones NERD produced with the hidden-gene but the ones without it.
Does it look like a lesser bee ? Or it's a bit different ?
Thank you
And does anyone have any idea if the lesser pearl NERD hatched in 2006 survived ? Cause we never heard of, so I would assume not, but well we never know, since he keep stuff secret
Thank you guys (and girls)
Kevin has stated that the Pearl appears to be a lethal combination, he's not had any survive. I've not seen any adult Pearls the two times I've spent a week there, with full access to their collection, so I don't believe he's keeping that secret.
I am not sure I've seen a picture of a lesser/woma (no hidden gene) combo.
-
-
BPnet Veteran
Re: Woma - Lesser Picture ? (No hidden gene)
 Originally Posted by rabernet
Kevin has stated that the Pearl appears to be a lethal combination, he's not had any survive. I've not seen any adult Pearls the two times I've spent a week there, with full access to their collection, so I don't believe he's keeping that secret.
I am not sure I've seen a picture of a lesser/woma (no hidden gene) combo.
Thank you 
I tought the exact same thing, no pearl survived yet. But I also heard that with other combination, they could survive, but I have never seen any of those, other than the baby lesser pearl from 2006 I think.
-
-
Re: Woma - Lesser Picture ? (No hidden gene)
 Originally Posted by Watever
Does any one have a picture of a normal woma-lesser ?
Not the ones NERD produced with the hidden-gene but the ones without it.
Does it look like a lesser bee ? Or it's a bit different ?
-
The Following User Says Thank You to Louis Kirkland For This Useful Post:
-
Registered User
Re: Woma - Lesser Picture ? (No hidden gene)
-
The Following User Says Thank You to DarkComeSoon For This Useful Post:
-
Re: Woma - Lesser Picture ? (No hidden gene)
I am sorry to question you Louis but I do not see any of the indicators that I come to associate with Woma in that animal (head patch, moustache, light eye...) Are you cetain on the ID?
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
BPnet Veteran
Re: Woma - Lesser Picture ? (No hidden gene)
Thank you very much Louis !!!
asplundii : There is lot of variation in the woma, like in the spider. With the funky pattern, I think it's one. Remember that lesser will modify the pattern also etc...
-
The Following User Says Thank You to Watever For This Useful Post:
-
Re: Woma - Lesser Picture ? (No hidden gene)
Wat: Yeah I know Woma have a lot of variation

But some of the things are kind of diffinative to the morph... things I would look for in determining a combo. I know Lesser will modify the pattern but I would not expect it to erase all of the traits I have come to associate with a Woma...
Also, I am not trying to say that that animal is not the combo. I am just saying that I do not see it. If Louis can tell me what identifiers he is using I might very well be able to see the combo nature... as it is though that just looks like a really nice Lesser to me
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: Woma - Lesser Picture ? (No hidden gene)
 Originally Posted by asplundii
I am sorry to question you Louis but I do not see any of the indicators that I come to associate with Woma in that animal (head patch, moustache, light eye...) Are you cetain on the ID?
He was produced by Ballistic Morphs. Here's a pic of his mom that Debbie sent me when I purchased him.
-
-
Re: Woma - Lesser Picture ? (No hidden gene)
 Originally Posted by asplundii
... as it is though that just looks like a really nice Lesser to me
When you see him in person (in snake?) he looks very different from any of the Lessers we have. The pattern is different as are the colors. It's hard to capture his true colors in a photograph. I know because I've tried several times without success. 
While I'm posting pics, here is one Debbie sent me of his daddy.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|