Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,414

2 members and 1,412 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,937
Threads: 249,130
Posts: 2,572,295
Top Poster: JLC (31,651)
Welcome to our newest member, GeorgiaD182
Results 1 to 9 of 9
  1. #1
    BPnet Senior Member jglass38's Avatar
    Join Date
    08-28-2004
    Location
    New Jersey
    Posts
    10,055
    Thanks
    215
    Thanked 509 Times in 244 Posts
    Images: 1

    Lateralis - These guys are FAST!

    So I got my new colony of Lateralis in the mail today. 2000 large roaches! First thing I notice is that they are very quick. It'll be interesting to see the gex chase after them. I put a line of clear packing tape around the inside of the tub to stop escapes. I did notice that they can't even climb an inch on the side of the tub. I am trying to avoid escapes as best I can. How does everyone who breeds these get them from the tub into the lizard tubs? I have the same problem with my Dubia. I feel like I need something like they have at Petco to scoop up the crickets.

  2. #2
    No One of Consequence wilomn's Avatar
    Join Date
    05-18-2007
    Posts
    5,063
    Thanks
    123
    Thanked 2,795 Times in 1,171 Posts
    Images: 109

    Re: Lateralis - These guys are FAST!

    Quote Originally Posted by jglass38 View Post
    So I got my new colony of Lateralis in the mail today. 2000 large roaches! First thing I notice is that they are very quick. It'll be interesting to see the gex chase after them. I put a line of clear packing tape around the inside of the tub to stop escapes. I did notice that they can't even climb an inch on the side of the tub. I am trying to avoid escapes as best I can. How does everyone who breeds these get them from the tub into the lizard tubs? I have the same problem with my Dubia. I feel like I need something like they have at Petco to scoop up the crickets.
    Ummmm Dude, don't you have a girlfriend?

    You do know that feeding is her job. Right? Same with cleaning and all other nasty things that go with keeping reptiles and bugs and rodents.
    I may not be very smart, but what if I am?
    Stinky says, "Women should be obscene but not heard." Stinky is one smart man.
    www.humanewatch.org

  3. #3
    BPnet Senior Member jglass38's Avatar
    Join Date
    08-28-2004
    Location
    New Jersey
    Posts
    10,055
    Thanks
    215
    Thanked 509 Times in 244 Posts
    Images: 1

    Re: Lateralis - These guys are FAST!

    Quote Originally Posted by wilomn View Post
    Ummmm Dude, don't you have a girlfriend?

    You do know that feeding is her job. Right? Same with cleaning and all other nasty things that go with keeping reptiles and bugs and rodents.
    You don't know my girlfriend! Hahaha....I'll try it out on her though and see what kind of response I get. I'll let you know how it goes...

  4. #4
    in evinco persecutus dr del's Avatar
    Join Date
    04-20-2006
    Location
    Edinburgh, Scotland
    Posts
    24,527
    Thanks
    9,263
    Thanked 6,788 Times in 4,306 Posts
    Images: 93

    Re: Lateralis - These guys are FAST!

    Hi,

    How does the packing tape work?

    Do you put it sticky side out (double sided?) so they get stuck before they escape or smooth side out and they just cant get a grip?

    I was wondering because I saw someone talking about it on a glass tank and I thought the glass would have been slicker.

    On the transferring thing can't you make either a seive scoop with a lid or one of those "bug pooter" things?


    dr del
    Derek

    7 adult Royals (2.5), 1.0 COS Pastel, 1.0 Enchi, 1.1 Lesser platty Royal python, 1.1 Black pastel Royal python, 0.1 Blue eyed leucistic ( Super lesser), 0.1 Piebald Royal python, 1.0 Sinaloan milk snake 1.0 crested gecko and 1 bad case of ETS. no wife, no surprise.

  5. #5
    BPnet Senior Member jglass38's Avatar
    Join Date
    08-28-2004
    Location
    New Jersey
    Posts
    10,055
    Thanks
    215
    Thanked 509 Times in 244 Posts
    Images: 1

    Re: Lateralis - These guys are FAST!

    Quote Originally Posted by dr del View Post
    Hi,

    How does the packing tape work?

    Do you put it sticky side out (double sided?) so they get stuck before they escape or smooth side out and they just cant get a grip?

    I was wondering because I saw someone talking about it on a glass tank and I thought the glass would have been slicker.

    On the transferring thing can't you make either a seive scoop with a lid or one of those "bug pooter" things?


    dr del
    Derek,

    I put it smooth side out so they can't get a grip. I think it's actually more slick than glass.

    I think more like this might work for me: http://www.premiumcrickets.com/Cricket-Scoop.html


    J

  6. The Following User Says Thank You to jglass38 For This Useful Post:

    dr del (07-16-2009)

  7. #6
    Registered User
    Join Date
    12-07-2008
    Posts
    170
    Thanks
    6
    Thanked 21 Times in 18 Posts
    Images: 7

    Re: Lateralis - These guys are FAST!

    I just use feeding tongs for my dubia.
    __________________

    Chad
    www.iherp.com/wafisherman

    Ball Python, 2 Dumiril's Boas, Mexican Boa
    Russian Tortoise, 3 Sulcata Tortoises,
    3 E. Box Turtles and one 3-Toed Box Turtle
    Dog, Cat, Bearded Dragon
    2 Leo Geckos, Tiger Salamander, 2 Water Dragons
    Chickens, Rabbits, Ducks, Pilgram Geese
    2 Olberhasli milking goats
    7 kids and one amazing wife!

  8. #7
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Lateralis - These guys are FAST!

    You should not need the packing tape for the latteralis, they are non climbers. I never use it and have never had an escapee.

    To feed... I use paper towel tubes in the tubs as hides for the roaches and then I have 32oz deli cups. I take a tub and knock the inhabitants into the cup and drop a lid on. Then I use forceps to either feed out of the cup or transfer intot he tank.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  9. #8
    BPnet Lifer Skiploder's Avatar
    Join Date
    03-03-2007
    Location
    Under a pile of wood.
    Posts
    3,580
    Thanks
    113
    Thanked 3,727 Times in 1,257 Posts
    Images: 1

    Re: Lateralis - These guys are FAST!

    Quote Originally Posted by asplundii View Post
    You should not need the packing tape for the latteralis, they are non climbers. I never use it and have never had an escapee.

    To feed... I use paper towel tubes in the tubs as hides for the roaches and then I have 32oz deli cups. I take a tub and knock the inhabitants into the cup and drop a lid on. Then I use forceps to either feed out of the cup or transfer intot he tank.
    Ditto. I use egg crate and paper towel tubes. I knock them into a cup with mineral in it and give 'em a good shake.

    As an aside - after two years on roaches my ackies refuse to take them. I haven't changed the roach diet - I'm wondering it anyone else has had their lizards refuse roaches after being on them.

  10. #9
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Lateralis - These guys are FAST!

    Not my lizards but I have 2 of 4 waxie tree frogs that started refusing latteralis. However they are taking to lobsters with a new found gusto so...
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1