Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 2,060

2 members and 2,058 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,055
Threads: 249,211
Posts: 2,572,728
Top Poster: JLC (31,651)
Welcome to our newest member, BlueRing
Page 2 of 3 FirstFirst 123 LastLast
Results 11 to 20 of 22

Thread: for the experts

  1. #11
    BPnet Veteran PythonWallace's Avatar
    Join Date
    02-26-2007
    Location
    Woodridge, IL
    Posts
    2,967
    Thanks
    204
    Thanked 346 Times in 210 Posts
    Images: 23

    Re: for the experts

    Quote Originally Posted by bobbittle View Post
    NERD says it's a random occurrence. I think the "faded" albinos and the "high contrast" albinos are more of a selectively bred trait, and not an actual mutation themselves. They are all just T- albinos. If it were a proven mutation, seperate from your every day albinos, you could breed a faded albino to any dark normal, and breed any of the hets together or back to the original faded albino and end up with all faded albinos every time. They wouldn't likely be compatible with your common T- albino, and the amount of xanthiphore in the breeding stock wouldn't have an effect on the faded homozygous albinos, and I don't know that to be the case.
    What are these mojavas I keep hearing so much about?

    J. W. Exotics

    Reptile Incubators

  2. #12
    Old enough to remember. Freakie_frog's Avatar
    Join Date
    08-12-2004
    Location
    221b Baker Street
    Posts
    16,636
    Thanks
    462
    Thanked 3,884 Times in 2,148 Posts
    Blog Entries
    2
    Images: 107

    Re: for the experts

    Jake I feel like your right on with the line breeding thing. We've seen it in Lessers, Pastels, and even Cinni's.

    I think the contrast is a line bred aberrant trait much like allot of the different "Lines" are in different morphs
    When you've got 10,000 people trying to do the same thing, why would you want to be number 10,001? ~ Mark Cuban
    "for the discerning collector"



  3. #13
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: for the experts

    Quote Originally Posted by PythonWallace View Post
    I think the "faded" albinos and the "high contrast" albinos are more of a selectively bred trait, and not an actual mutation themselves.
    Quote Originally Posted by Freakie_frog View Post
    Jake I feel like your right on with the line breeding thing. We've seen it in Lessers, Pastels, and even Cinni's.
    I am inclined to disagree that it is a "line bred" occurrence. Lessers/pastels/cinnys that are born higher or lower grade stay higher or lower grade. A faded albino is born faded but eventually colours up to a point that you would not be able to tell it from an animal that was born high contrast. IDK if he has posted them here but on another forum Albey has some then and now pics of his faded albino, at birth it looked like a snow and now it looks like a really nice HC albino.

    They are all just T- albinos. If it were a proven mutation, seperate from your every day albinos, you could breed a faded albino to any dark normal, and breed any of the hets together or back to the original faded albino and end up with all faded albinos every time. They wouldn't likely be compatible with your common T- albino, and the amount of xanthiphore in the breeding stock wouldn't have an effect on the faded homozygous albinos, and I don't know that to be the case.
    It is possible to be a proven mutation that is "compatible" with a "common" T- albino. Based on some discussions on another forum I (and a few others it seems) are wondering if maybe the faded phenotype is the result of a second site mutation. If that is the case, depending on the mechanism of that second site mutation, breeding a faded to a normal and then breeding the offspring back together would give you a 1 in 8 or a 1 in 16 chance of getting a faded.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  4. #14
    Old enough to remember. Freakie_frog's Avatar
    Join Date
    08-12-2004
    Location
    221b Baker Street
    Posts
    16,636
    Thanks
    462
    Thanked 3,884 Times in 2,148 Posts
    Blog Entries
    2
    Images: 107

    Re: for the experts

    Quote Originally Posted by asplundii View Post
    I am inclined to disagree that it is a "line bred" occurrence. Lessers/pastels/cinnys that are born higher or lower grade stay higher or lower grade. A faded albino is born faded but eventually colours up to a point that you would not be able to tell it from an animal that was born high contrast. IDK if he has posted them here but on another forum Albey has some then and now pics of his faded albino, at birth it looked like a snow and now it looks like a really nice HC albino.
    Correct but you can produce Mojaves that look like Lessers and Lessers the look like mojaves.
    As for Pastels I can tell you with 100% certainty that you can breed a great looking pastel to a darker female and your offspring will show it.
    When you've got 10,000 people trying to do the same thing, why would you want to be number 10,001? ~ Mark Cuban
    "for the discerning collector"



  5. #15
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: for the experts

    Quote Originally Posted by Freakie_frog View Post
    Correct but you can produce Mojaves that look like Lessers and Lessers the look like mojaves.
    As for Pastels I can tell you with 100% certainty that you can breed a great looking pastel to a darker female and your offspring will show it.
    You will not get any argument from me on those examples. But it does not change the fact that faded albinos are not the result of breeding for a faded looking animal. They just pop up. People are not taking "pale" adult albinos and breeding them to other "pale" animals with the intent of making faded albinos. As adults (or in just 2-3 sheds) the faded babies look like normals and most people likely do not know or care that they were born faded and just use them to make more albinos.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  6. #16
    Registered User
    Join Date
    09-03-2008
    Posts
    34
    Thanks
    5
    Thanked 0 Times in 0 Posts

    Re: for the experts

    this it what he is looking like


  7. #17
    Old enough to remember. Freakie_frog's Avatar
    Join Date
    08-12-2004
    Location
    221b Baker Street
    Posts
    16,636
    Thanks
    462
    Thanked 3,884 Times in 2,148 Posts
    Blog Entries
    2
    Images: 107

    Re: for the experts

    Yep he's a faded Albino
    When you've got 10,000 people trying to do the same thing, why would you want to be number 10,001? ~ Mark Cuban
    "for the discerning collector"



  8. The Following User Says Thank You to Freakie_frog For This Useful Post:

    Seadevil (07-14-2009)

  9. #18
    Registered User
    Join Date
    09-03-2008
    Posts
    34
    Thanks
    5
    Thanked 0 Times in 0 Posts

    Re: for the experts

    Quote Originally Posted by Freakie_frog View Post
    Yep he's a faded Albino
    and he is 2 years now and still no change's after shedding

  10. #19
    BPnet Veteran ItsMichael805's Avatar
    Join Date
    03-23-2009
    Location
    Camarillo, California
    Posts
    1,027
    Thanks
    100
    Thanked 118 Times in 113 Posts
    Images: 4

    Re: for the experts

    wow you can barley see the yellow, i thought it was just white.
    0.1 Normal Ball Python

  11. #20
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: for the experts

    My SNAFU. I was thinking blush albinos not faded albinos.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

Page 2 of 3 FirstFirst 123 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1